Posts Tagged ‘inteligencia artificial’

Como usar los datos en medicina

6 septiembre, 2015

El Aprendizaje automático y la ciencia de Datos van a Hacer Más pára Mejorar la Salud de TODAS LAS CIENCIAS BIOLÓGICAS Combinadas.

Sourced through Scoop.it from: singularityhub.com

LA IMPORTANCIA DE USAR DATOS EN MEDICINA ¿Cuál es la gran idea?

—————————————————–
Su genoma consta de aproximadamente 3.2 mil millones de pares de bases (el ADN) que codifican literalmente tu yo, es decir, toda tu persona. Su código de genes determina las enfermedades que podría tener, si es bueno en matemáticas o con la música, como será su memoria y cuan buena es, cómo te ves fisicamente, como te sientes, cuánto tiempo es probable que vivas y muchos más datos. Esto significa que si podemos descifrar este código genómico podemos predecir su futuro biológico y trabajar para anticipar y mejorar su salud.
—————
Es un problema de datos – y si usted es un científico de datos o experto de aprendizaje de máquinas- esto será el problema más interesante e importante que podría tratar de solucionar. En términos más simples, secuenciar un genoma significa convertir el ADN en una serie de cuatro letras que se parece a esto:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Y ese genoma es un archivo de texto de unos 300 gigabytes.
————–
Al comparar su genoma secuenciado con millones de genomas de otras personas y el conjuntos de datos de los servicios de salud, podemos usar la máquina de aprendizaje y técnicas de minería de datos, para correlacionar ciertos rasgos (color de los ojos, lo que su cara parece) o enfermedades (Alzheimer, Huntington, etc.) a ciertos factores en los datos y comenzar a desarrollar diagnósticos/terapias personalizadas. Manipular los datos biológicos es como un problema de traducción, como el Google Translate. La base de datos biológicos es HLI, y todo el mundo entra en ella. Los conjuntos de datos creados incluyen lo siguiente:

Genómica: Los 3.2 mil millones de nucleótidos de madre igual de su padre.
Microbioma: El genoma de los 100 billones + microorganismos de nuestro cuerpo.
La MRI/Imagenología: imágenes detalladas del cerebro, los órganos y el cuerpo.
Metabolome: Los 2.300 moléculas en el torrente sanguíneo.
Datos de Salud Fisiológica: Todos los datos de nosotros mismos: signos vitales, niveles de glucosa en sangre, los micro ARN en la circulación sanguínea, la frecuencia cardíaca, VO2 …
Si traducimos todos estos datos obtendremos un resulado de tu salud. Similar a cómo Google Translate actúa.
—————-
El Traductor de Google (GT) usa un proceso llamado traducción automática estadística, lo que significa que GT genera traducciones basadas en patrones que se encuentran en grandes cantidades de texto escrito. En vez de enseñar a la computadora todas las reglas de todos los idiomas, este enfoque permite que ella descubra las normas por sí misma en base a los patrones estadísticos significativos en los datos. Una vez que halla estos patrones, puede usar este “modelo” para traducir el texto similar en el futuro. Asi traduce en 90 idiomas diferentes. El reto ahora es usar lo mismo con la Genética, los registros de salud, y nos encontramos a la persona perfecta para liderar este esfuerzo: Franz Och – el hombre responsable de la construcción de Google Translate. “La gran misión es aprender a interpretar el genoma humano y ser capaces de predecir cualquier cosa que nos pasa a partir del código fuente”.
—————-
HLI está buscando ahora mismo lo siguiente: fuertes ingenieros de software que pueden construir de alta calidad, software fiable y de alto rendimiento, Expertos de aprendizaje automático y Estadísticas expertos. Aqui puede aplicar: http://www.humanlongevity.com/careers/open-positions/

ñada su visión …

See on Scoop.itNovedades Cientificas y Médicas

La evolución hoy

18 agosto, 2015

EL PAPEL DE LA EVOLUCIÓN HOY
————————–
Parece lógico pensar que la sabia evolución, la cual sólo se preocupó de mantenernos sanos, con el objetivo de lograr la reproducción mas óptima y así, en teoría, lograr el mejor producto para la próxima generación venidera, fue todo un éxito. Asi logramos conseguir y garantizar la mejor evolución de nuestra especie, como tal. El papel de la evolución en todo este lento desarrollo como especie, fue esencial, simple y efectivo. Así la evolución nos llevó a producir los Galileos, Newton, Einstein, Darwin, etc. que nos pusieron a la altura de la ciencia que hoy ya conocemos. La frutilla de esta torta evolutiva fue puesta por la aparición y desarrollo de dos áreas que cambiaron las reglas: 1) la Genética en la biología posibilitó trascender a la evolución o manipularla y 2) el avance de la computadoras y la Inteligencia artificial que nos catapultan en el manejo de datos, rapidez y eficiencia de los conocimientos.
————
Llegados a este punto, donde nos es posible programar una biología humana mejor a la que ya tenemos, sin la necesidad de recurrir a los millones de años que tuvimos que invertir con la evolución natural para llegar al punto en que estamos. Es claro que ahora, el proceso de nacer, crecer, reproducirnos y morir, parece haber dejado de tener un sentido o necesidad racional, a nivel biológico. La muerte ahora más bien, representa una demora en ese proceso de evolucionar: dejó de ser necesaria, como tantas otras cosas que la ciencia nos ha enseñado. A su vez, la Inteligencia Artificial en el área de la computación, ha mostrado el mejor camino para aprender más rápido y sin los errores humanos que tuvimos que superar en el pasado. Los algoritmos computacionales nos permitirán usar toda la información que ya tenemos y también la información futura que produzcamos y podremos sacar de ella, todas las conclusiones que necesitamos.
————
Esto era impensables hace unas pocas décadas. Pero hoy, todo parece indicar que ya sólo hace falta tomar consciencia de lo aqui expuesto y aplicar los recursos necesarios para obtener un desarrollo adecuado. El futuro próximo puede ser completamente distinto a lo que todos hemos creído. ¿Cuánto demoraremos en identificar el rumbo correcto y encender los motores?. No lo sabemos. Nuestra sociedad es un poco confusa aún y los medios de comunicación, manejados en su gran mayoría con criterios comerciales, no tienen suficientes conocimientos para manejar estos temas en el corto plazo. Es probable que, tal como ocurriera en el pasado, debamos esperar unas cuantas décadas de confusión y desvíos, para que al final, la sociedad en su mayoría, vislumbre hacia adonde ir y termine apoyando todas estas cuestiones. No será fácil ni rápido y estará plagado de anuncios apocalípticos, como todos los grandes cambios.
————
REF (ago 2015)

See on Scoop.itNovedades Cientificas y Médicas

Proyecto Manhattan “Beach”

27 junio, 2013

Tal como se estableció el Proyecto Manhattan en 1942 para construir la bomba atómica para terminar la Segunda Guerra Mundial, el Proyecto Manhattan “Beach” fue fundada en la conferencia original, el 23 de junio del 2000, como un asalto total contra el Envejecimiento y la muerte provocada por esa circunstancia. Los mejores cientificos dedicados a la cura de la vejez se reunieron y crearon este proyecto que solo busca prolongar la vida humana, tanto como la ciencia lo permita. Los científicos ya están avanzando por el camino de la restauración de la  juventud. De hecho, muchos de los principales médicos e investigadores en el mundo han colaborado en silencio durante años en ciencias estratégicas para frenar y revertir por completo el proceso de envejecimiento humano. En 100 años serán llamados genios o locos, como siempre ocurre con quienes se atreven a desafiar al orden establecido. Ya considerar a la vejez como una enfermedad es todo un desafio!.

 

La primera conferencia científica anti-envejecimiento se celebró en Manhattan Beach, California hacei 13 años. Esto no fue un congreso ordinario. Los Doce mejores investigadores de todo el mundo han unido su talento y de su nivel de experiencia en sus especialidades específicas, y sentaron las bases de lo que se convirtió en un plan de trabajo científico para la plena edad de reversión. Ahora en el 2011 se puso en marcha oficialmente el proyecto. La idea es ver si esta es la última generación a deteriorarse, sufrir y morir a causa de envejecimiento, o será parte de la primera generación para lograr el sueño humano, quizás más antiguo, ser jóven con salud y la vitalidad. Nuestro modelo científico está avalado por reconocidos científicos y gerontólogos especialistas en antienvejecimiento del mundo. Algunos dan un 90% de probabilidad de revertir el envejecimiento en mamíferos de laboratorio dentro de 10 años, con un presupuesto anual de menos de $ 100 millones. El objetivo es simple: debemos ser capaces de revertir el envejecimiento en un ser humano en el año 2029. 

Veamos un resumen en español de lo expuesto en las fotos, con el fin de revertir los daños del envejecimiento, es muy probable que sólo tenemos que madurar las siguientes tecnologías y ciencias. Algunas de las tecnologías actuales están diseñados para prolongar su vida. Se están desarrollando proyectos a más largo plazo para transformar las personas mayores en las personas jóvenes y mantenerlos joven y saludable.

  • Restricción calórica – Varias compañías están desarrollando fármacos que imitan los efectos de la restricción calórica. Hasta el momento, la restricción calórica es la única manera de extender la máxima vida útil de los mamíferos aproximadamente un 30 % o más.
  • Genómica Evolutiva – Una compañía de California se ha extendido la vida útil de los animales de laboratorio en un 300%. A continuación, se identificaron aproximadamente 300 genes relacionados con el envejecimiento que pueden ser idénticos a los genes humanos. Ahora se están identificando y compuestos que pueden activar los genes de extender la vida humana en desarrollo.
  • Mantenimiento de los telómeros – Cada vez que las células se dividen, los telómeros, las pequeñas cadenas en los extremos de los cromosomas, se acortan. Con el tiempo, se vuelven demasiado cortos para mantener la vida de la célula, y muere. Las empresas están descubriendo compuestos que alargan los telómeros acortados, y uno ya está vendiendo su producto (TA65)
  • Manipulación de genes del Envejecimiento – Muchas empresas están descubriendo genes relacionados con el envejecimiento y los están engañando a actuar en el mejor interés de su longevidad.
  • Modulación Inmune System – Una nueva compañía ha descubierto una manera de analizar su sistema inmunológico y ofrecer medidas para restablecer al estado en que estaba cuando era un adulto joven.
  • Envejecimiento y Regeneración extracelular – A medida que nuestros cuerpos se estresan por nuestro medio ambiente y por los alimentos que comemos, algunas de las proteínas o las grasas y los azúcares se enredan. Esto se conoce como reticulación y el resultado es similar al cuero viejo seco y agrietado. Esto le sucede a usted, por dentro y por fuera. Las empresas han desarrollado compuestos para frenar o detener la reticulación y están trabajando en maneras de revertirla.
  • Células Madre/Medicina Regenerativa – Ciencia está marchando rápidamente hacia adelante para utilizar células de reemplazo para reparar o incluso reemplazar casi todos los órganos del cuerpo.
  • Tejidos/órganos de almacenamiento – A medida que envejece, sus células, tejidos y órganos se deterioran. Ahora las empresas están almacenando las células, y pronto, es posible que se puedan almacenar respaldo de tejidos jóvenes y órganos.
  • SENS/Rejuvenecimiento mitocondrial – La ciencia ha descubierto que puede ser mucho más fácil de reparar los daños del envejecimiento en lugar de la prevención de los daños que se produzcan en el primer lugar. Usted podría tener su cuerpo reparado periódicamente y mantenerlo en marcha indefinidamente.
  • Atacar la Demencia – A medida que vivimos más tiempo, somos más propensos a desarrollar demencia. Una nueva compañía ha desarrollado un compuesto que detener la progresión de la enfermedad de Alzheimer, el Parkinson y la esclerosis lateral amiotrófica. El siguiente paso sería la de revertir y curar las enfermedades mismas.
  • Artificial Intelligence general – Imagine un equipo de investigadores que trabajan todo el día durante años a la vez sin descanso. Luego imagine que aprende casi al instante con 100% de retención. Esto son los proyectos de Inteligencia Artificial que se vienen.
  • Nanomedicina – Ahora imagina una tecnología que podría solucionar todos y cada uno de las decenas de miles de millones de células en su cuerpo. Eso significa ser capaz de restaurar todo el cuerpo.
  • Reingeniería del Genoma – En cada una de sus células, existen unos 25.000 programas de computadora, que son los genes. Estamos ganando rápidamente el conocimiento para reprogramar los genes para que sean resistentes o inmunes a la enfermedad e incluso el envejecimiento.
  • La utilización de la tecnología de hoy y del Conocimiento para prolongar la vida – Sabemos lo suficiente ahora para añadir al menos diez años de esperanza de vida promedio. La utilización de ese conocimiento podría añadir bastantes años a su vida para mantenerlo vivo hasta que la ciencia es capaz de transformarse en una versión más joven de sí mismo biológicamente.
  • La criónica – ¿Y si todo lo demás falla en su vida? Entonces tenemos una forma de animación suspendida llamado criónica que podría mantener a las células contra el deterioro después de la muerte “legal” y restaurar la salud y la juventud en el futuro.
A %d blogueros les gusta esto: