Posts Tagged ‘genoma’

Como usar los datos en medicina

6 septiembre, 2015

El Aprendizaje automático y la ciencia de Datos van a Hacer Más pára Mejorar la Salud de TODAS LAS CIENCIAS BIOLÓGICAS Combinadas.

Sourced through Scoop.it from: singularityhub.com

LA IMPORTANCIA DE USAR DATOS EN MEDICINA ¿Cuál es la gran idea?

—————————————————–
Su genoma consta de aproximadamente 3.2 mil millones de pares de bases (el ADN) que codifican literalmente tu yo, es decir, toda tu persona. Su código de genes determina las enfermedades que podría tener, si es bueno en matemáticas o con la música, como será su memoria y cuan buena es, cómo te ves fisicamente, como te sientes, cuánto tiempo es probable que vivas y muchos más datos. Esto significa que si podemos descifrar este código genómico podemos predecir su futuro biológico y trabajar para anticipar y mejorar su salud.
—————
Es un problema de datos – y si usted es un científico de datos o experto de aprendizaje de máquinas- esto será el problema más interesante e importante que podría tratar de solucionar. En términos más simples, secuenciar un genoma significa convertir el ADN en una serie de cuatro letras que se parece a esto:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Y ese genoma es un archivo de texto de unos 300 gigabytes.
————–
Al comparar su genoma secuenciado con millones de genomas de otras personas y el conjuntos de datos de los servicios de salud, podemos usar la máquina de aprendizaje y técnicas de minería de datos, para correlacionar ciertos rasgos (color de los ojos, lo que su cara parece) o enfermedades (Alzheimer, Huntington, etc.) a ciertos factores en los datos y comenzar a desarrollar diagnósticos/terapias personalizadas. Manipular los datos biológicos es como un problema de traducción, como el Google Translate. La base de datos biológicos es HLI, y todo el mundo entra en ella. Los conjuntos de datos creados incluyen lo siguiente:

Genómica: Los 3.2 mil millones de nucleótidos de madre igual de su padre.
Microbioma: El genoma de los 100 billones + microorganismos de nuestro cuerpo.
La MRI/Imagenología: imágenes detalladas del cerebro, los órganos y el cuerpo.
Metabolome: Los 2.300 moléculas en el torrente sanguíneo.
Datos de Salud Fisiológica: Todos los datos de nosotros mismos: signos vitales, niveles de glucosa en sangre, los micro ARN en la circulación sanguínea, la frecuencia cardíaca, VO2 …
Si traducimos todos estos datos obtendremos un resulado de tu salud. Similar a cómo Google Translate actúa.
—————-
El Traductor de Google (GT) usa un proceso llamado traducción automática estadística, lo que significa que GT genera traducciones basadas en patrones que se encuentran en grandes cantidades de texto escrito. En vez de enseñar a la computadora todas las reglas de todos los idiomas, este enfoque permite que ella descubra las normas por sí misma en base a los patrones estadísticos significativos en los datos. Una vez que halla estos patrones, puede usar este “modelo” para traducir el texto similar en el futuro. Asi traduce en 90 idiomas diferentes. El reto ahora es usar lo mismo con la Genética, los registros de salud, y nos encontramos a la persona perfecta para liderar este esfuerzo: Franz Och – el hombre responsable de la construcción de Google Translate. “La gran misión es aprender a interpretar el genoma humano y ser capaces de predecir cualquier cosa que nos pasa a partir del código fuente”.
—————-
HLI está buscando ahora mismo lo siguiente: fuertes ingenieros de software que pueden construir de alta calidad, software fiable y de alto rendimiento, Expertos de aprendizaje automático y Estadísticas expertos. Aqui puede aplicar: http://www.humanlongevity.com/careers/open-positions/

ñada su visión …

See on Scoop.itNovedades Cientificas y Médicas

Trazan 1er. Mapa Epigenético

18 febrero, 2015

If the genome is the musical score of life, the epigenome is how the orchestra goes about playing it.

Source: www.washingtonpost.com

CARTOGRAFÍA DEL EPIGENOMA HUMANO
—————-
El epigenoma humano es lo que hace que un gen no dependa solo de su secuencia (gattacca), sino que hay otras cosas que pueden influir sobre esto (de ahí el agregado de “epi”, el que literalmente significa “encima de”), como son los grupos más sencillos de la química orgánica (metilo, CH3) y ciertas proteínas especializadas en empaquetar el ADN llamadas histonas. Esto explica que aunque todas las células tengan el mismo genoma, unas se conviertan al final en células de la piel, otras en neuronas y así hasta los más de un centenar (111) de tipos celulares especializados, o diferenciados, que constituyen el cuerpo humano.
—————–
Los investigadores han lanzado la cartografía más completa del epigenoma humano hasta la fecha, utilizando el análisis masivo de datos para entender cómo y por qué los genes se pueden apagar y encender en las células humanas. Su trabajo, publicado el miércoles en la revista Nature , podría conducir a nuevos tratamientos para una multitud de enfermedades, incluyendo el cáncer. Este macroproyecto revela hoy el mapa epigenómico humano, que localiza dónde están esas modificaciones (metilos, histonas) en todos los tipos celulares importantes del cuerpo humano y también en 58 enfermedades (genéticamente) complejas. Como pasó con el proyecto Genoma Humano, la información se hará pública y gratuita para todo el mundo.
————–
Los investigadores y el profesor del MIT Manolis Kellis analizaron un total de 150.000 millones de Secuenciaciónes del Genoma. Se uso de un algoritmo especialmente desarrollado, para ver este conjunto de datos de forma masiva y buscar cambios epigenómicos en 111 tipos de células diferentes. La tarea de secuenciación se lleva a cabo bajo un programa de investigación de 10 años del Gobierno estadounidense, el Programa de Hoja de Ruta de Epigenómica, lanzado en el 2008 con un financiamiento de 240 millones de dólares y asi se llegó a estos interruptores moleculares que pueden encender o silenciar genes individuales en el ADN en más de 100 tipos de células humanas
Las diferentes combinaciones de marcas epigenéticas caracterizan diferentes regiones del genoma, lo que refleja las funciones específicas que desempeñan en cada célula, nos dice Kellis.
————-
Al estudiar estas combinaciones sistemáticamente, podemos aprender el idioma del epigenoma y lo que nos dice de su actividad y función en cada región genómica y en cada uno de los tipos de células. En uno de los estudios publicados los investigadores ataron cambios celulares específicos a 58 rasgos biológicos diferentes. A veces los cambios epigenómicos de una célula revelan posibles pistas sobre una enfermedad. Como ejemplo, se encontraron mutaciones asociadas con el Alzheimer que cambian la actividad genómica de las células inmunes, no sólo de las células cerebrales. Esto se halló en un modelo de ratón, por lo que podría no aplicarse a nosotros, pero si lo hace, daría nuevas áreas para tener en cuenta cuando se intenta tratar la enfermedad.
————–
La numerología del proyecto escapa al ámbito de las grandes cifras: más de 100 tejidos primarios y tipos celulares, 2.800 experimentos cada uno a escala del genoma entero, 150.000 millones de sondas o fragmentos de ADN que cubren el genoma 3.000 veces. Ahora ya pueden ver que, las variantes genéticas asociadas a la diabetes de tipo 1, la artritis reumatoide y la esclerosis múltiple están activas en las células del sistema inmune. Y esto es lógico, puesto que esas tres enfermedades pertenecen a la categoría autoinmune, es decir, que están causadas por un funcionamiento anómalo o excesivo de las defensas, que se dedican atacar a las células pancreáticas, articulares o nerviosas del propio paciente. Pero la lógica no sirve para encontrar tratamientos, y lo que tenemos ahora son datos duros que sí lo permitirán.
————
En la misma línea, las variantes genéticas asociadas con la presión arterial están activas en las células del corazón, las asociadas con un alto nivel de colesterol y por ello, asociadas con una probabilidad incrementada de infarto, funcionan en el hígado, como las asociadas a los trastornos metabólicos. Todo esto tiene su lógica también. Los datos obtenidos y no la pura lógica, será lo que permitirá avanzar en el conocimiento de estas enfermedades y buscar tratamientos eficaces. En el alzhéimer, puesto que se trata de una enfermedad neuro-degenerativa (que va matando neuronas progresivamente) cabría esperar que las variantes genéticas que lo favorecen estén activas en las neuronas, causando asi la acumulación de proteínas tóxicas amiloides, pero parece que no es así. Esas variantes funcionan en las células del sistema inmune: en concreto en las células denominadas monolitos CD14. Esto cambia por completo la perspectiva para investigar tratamientos preventivos o paliativos del alzhéimer.
————–

Los científicos ahora tendrán que descifrar cómo el epigenoma afecta los genes, y también determinar cómo la vida que llevan las personas puede afectar su epigenoma. Una vida de factores ambientales y de hábitos de vida, son los que influyen en el epigenoma, como fumar, hacer ejercicio, hábitos alimenticios, exposición a químicos tóxicos e incluso la crianza. Esto es poner la salud practicamente en sus manos.

Ballenas boreales viven 2 siglos

8 enero, 2015

LAS BALLENAS BOREALES
————
La Universidad de Liverpool, Reino Unido, difundió el genoma completo de las ballenas boreales, animales que parecen casi inmunes al envejecimiento y el cáncer, ya que llegan a vivir más de 200 años. En el envejecimiento y el cáncer están implicados multitud de factores, desde características heredables hasta daños debidos al ambiente. El genoma de un organismo describe todas sus características heredables, antes de que se vean influidas por el ambiente. Este cetáceo posee dos copias del gen PCNA, encargado de reparar los daños en el genoma. Esta característica puede afectar a cáncer y envejecimiento a la vez, pues ambos procesos conllevan daños genómicos, pero también hemos notado cambios que afectan a genes de proteasas de las familias CPA y DUB, que podrían estar involucrados específicamente en protección frente al cáncer y al envejecimiento…
———
La conclusión principal es que este pequeño grupo de genes diferenciales puede contener claves importantes para entender el envejecimiento y el cáncer y la relación entre ambos procesos, una aproximación importante para nosotros porque nos permite analizar el problema desde un punto de vista distinto y complementario al de otros trabajos. Se sabe que ciertos cánceres obedecen a menudo a mutaciones aleatorias que se producen en el proceso de división de las células, y no tanto a causas genéticas o a un entorno desfavorable. Un estudio, publicado en la revista Science y realizado por científicos de la Universidad Johns Hopkins, está basado en un modelo estadístico que toma en cuenta gran variedad de tipos de enfermedades oncológicas. Excluye sin embargo el cáncer de mama, el más frecuente entre las mujeres, y el de próstata, el segundo más habitual entre los hombres después del cáncer de piel. De el puede extraerse que dos tercios de los cánceres producidos en adultos pueden explicarse por mutaciones genéticas aleatorias que hacen que los tumores crezcan, y un tercio son consecuencia de factores genéticos o de un entorno desfavorable.
————
Por lo expuesto, las personas que viven mucho tiempo sin contraer cáncer a pesar de ser fumadoras o exponerse al sol sin protecciones particulares no tienen por qué tener necesariamente buenos genes. La realidad es que muchas de ellas tienen simplemente mucha suerte. Por esto, el cambiar nuestros hábitos de vida será muy útil para evitar algunos tipos de cáncer, pero no tendrá ninguna eficacia en otros. Asi las cosas, en usted hay aún mucha responsabilidad sobre esto.
————-

See on Scoop.itNovedades Cientificas y Médicas

Actualizan Genoma Humano

5 julio, 2014

Un equipo del Centro Nacional de Investigaciones Oncológicas (CNIO) ha actualizado la cifra de genes que generan proteínas incluidos en el genoma humano y han…

Source: www.infosalus.com

ACTUALIZAN GENOMA HUMANO: 19.000 genes y mas de 12.000 PROTEÍNAS
—————
Un equipo del Centro Nacional de Investigaciones Oncológicas (CNIO) ha actualizado la cifra de genes que generan proteínas incluidos en el genoma humano y han reducido el listado a unos 19.000, 1.700 menos que los estimados en las últimas anotaciones y un número muy inferior a los 100.000 que se barajó hace años. Se publicó en la “Human Molecular Genetics” y fue dirigido por Alfonso Valencia, quién concluye que la práctica totalidad de estos genes tienen un origen anterior a la aparición de los primates hace más de 50 millones de años. La parte codificante del genoma (la que produce proteínas) está en constante movimiento. Nadie imaginó que con un número tan reducido de genes se podía hacer algo tan complejo, explican.
————–
Los científicos partieron de análisis proteómicos a gran escala para determinar el mapa de proteínas humanas “a partir del cual identificar aquellos genes que las producen y de esta manera verificar que existen”, explica Valencia. Para ello, integraron los datos procedentes de 7 trabajos anteriores de espectrometría de masas, la herramienta más potente para detectar moléculas, en este caso, proteínas procedentes de más de 50 tejidos humanos. Los resultados sacaron a la luz poco más de 12.000 proteínas, que casaron con las correspondientes regiones del genoma. Luego analizaron miles de genes que aparecían en otras bases de datos pero no en el estudio y concluyeron que 1.700 de los genes que se consideraban tales “no lo son por distintas razones”, bien porque no generan directamente proteínas o porque la lectura de sus letras no es compatible con la generación de las mismas, ha añadido Michael Tress, que también ha participado en el estudio.
—————-
Una hipótesis derivada del trabajo es que más del 90 % de los genes humanos que producen proteínas tienen su origen en metazoos u organismos pluricelulares del reino animal hace cientos de millones de años. La cifra es superior al 99 % para aquellos genes cuyo origen es anterior a la aparición de los primates hace más de 50 millones de años. “Nuestras cifras indican que las diferencias entre humanos y primates a nivel de genes o proteínas son muy pequeñas”, apuntan los investigadores. “El número de genes, Originados de nuevo en términos evolutivos, que separan a los humanos de los ratones –los cuales son anteriores a los primates en la escala evolutiva– podría ser inferior a diez“. Esta cifra contrasta con los más de 500 genes humanos originados de nuevo desde primates según datos procedentes de la anotación actual, por lo que “las diferencias fisiológicas y de desarrollo entre primates son sobretodo a nivel de regulación y no a las funciones básicas de las proteínas”.
—————
La fuentes de la complejidad humana radican más que en el número de genes, en cómo estos son utilizados, en las miles de modificaciones químicas que se producen en las proteínas o, según los últimos descubrimientos del proyecto internacional ENCODE en el que el equipo de Valencia participa, en el control de la producción de estas proteínas por las regiones no codificantes del genoma incluidas en el catalogado anteriormente como ADN basura, que compone el 90 % de la totalidad del genoma. El trabajo asemeja el número de genes humanos al de otras especies como la de los nemátodos ‘Caenorhabditis elegans’, unos gusanos de apenas un milímetro aparentemente menos complejos que el ser humano. No obstante, Valencia prefiere no hacer comparaciones, por lo que se tendrán que rehacer todos los cálculos, y no solo los del genoma humano.
—————-
El ADN se envuelve alrededor de las proteínas especializadas llamadas HISTONAS en el núcleo de la célula. Normalmente, las HISTONAS mantienen el ADN estrechamente empaquetado, evitando la expresión de los genes y la replicación de ADN, que son necesarios para el crecimiento y la división celular. Para que estas funciones críticas tengan lugar, las histonas deben ser modificados con la unión de un grupo ACETIL, donada por una molécula crítica llamada acetil-CoA. Este relaja el ADN y asi permite la replicación del ADN y la expresión génica. Este mecanismo se llama “regulación epigenética del ADN”, y es importante para las funciones normales (como el crecimiento de un embrión o funciones cerebrales) o en enfermedades comunes, tales como insuficiencia cardiaca o cáncer. Hasta ahora, la forma en que el núcleo genera acetil-CoA para la acetilación de histonas había permanecido esquivo.
—————

Las 50 empresas más inteligentes de 2013

20 marzo, 2014

See on Scoop.itNovedades Cientificas y Médicas

TOP 50 COMPAÑIAS MAS INNOVADORAS EN EL MUNDO

 

Refernan Ref‘s insight:

Las 50 empresas están clasificadas más o menos arbitrariamente. Sin embargo, tres empresas, Illumina, Tesla, y Google, lideran la lista de forma justificada gracias al grado de disrupción de sus tecnologías y la inteligencia con la que han construído sus negocios.

Illumina, es una compañía que aprovecha el mecanismo de copia fundamental de ADN con el fin de leer la secuencia de un genoma humano. (El proceso se denomina secuenciación por síntesis: bases etiquetadas mediante fluorescencia que se añaden a hebras individuales de ADN de una muestra y después se leen de forma masiva y multiplexada). A partir de una tecnología que inventó Solexa, Illumina aumentó el ritmo de secuenciación y logró bajar su costo (5 veces más rápido que la Ley de Moore). Las máquinas de Illumina son lindas a la vista: elegantes, sin botones y tan potentes que pueden generar un genoma por 1.000 dólares(730 euros).

Cuando se hizo el Proyecto del Genoma Humano costó 3,000 millones de dólares y en 2006 secuenciar un genoma humano costaba 10 millones de dólares. El impacto producirá nuevas categorías de medicamentos, mejor adecuación de los procesos terapéuticos así como información sorprendente sobre lo que nos hace humanos.

Las tecnologías de Illumina, google Glass y Bitcoin son disruptivas (en el sentido de que nuevos mercados para productos nuevos desplacen a mercados y productos de más edad, así como a todos los hábitos humanos asociados a ellos). Habrá que esperar su maduración.

See on www.technologyreview.es

7 Tecnología que cambiarán la medicina

8 marzo, 2012

Hace pocos días la revista ‘Forbes’, conocida por sus rankings de las personas más ricas del mundo, publicaba un artículo en el que se hacía eco de siete innovaciones tecnológicas dispuestas a revolucionar la sanidad del futuro.

Ciencia y tecnología se dan la mano en el futuro de la medicinaImagen de una ca

 
1) La información clínica en el bolsillo: ‘Patient Keeper’, desarrollado por dos profesores del Instituto de Tecnología de Massachusetts (MIT), es uno de estos prometedores proyectos. Es un programa informático que pretende facilitar el acceso de los médicos a toda la información clínica. Desde el portátil o la PDA, estos profesionales pueden, entre otros, consultar las citas planificadas para el día, pedir distintas pruebas, recetar medicamentos o controlar la evolución de los pacientes. Actualmente, unos 200 hospitales de EEUU ya lo utilizan.

2) Intercambiar información entre hospitales: La empresa HX Technologies es la segunda en aparecer en el artículo de la citada publicación económica. Su producto está destinado a acelerar el intercambio de información entre hospitales. Y, de esta forma, facilitar el envío de imágenes de alta resolución (como las obtenidas en un TAC) utilizando el ciberespacio como único soporte. Según presumen los miembros de esta empresa, “se podrían eliminar pruebas extra innecesarias y evitar al sistema médico de EEUU entre 5.000 y 6.000 millones de dólares anuales” (entre 3.400 y 4.100 millones de euros).

3) Tecnología desechable: El concepto propuesto por Xcellerex también podría revolucionar la práctica médica. Se trata de una alternativa para desarrollar y comercializar nuevas vacunas y bioterapias. Tal y como explican en su página web, a partir de una “plataforma tecnológica desechable” y una serie de productos de un sólo uso, se pueden obtener resultados “sin competencia” dispuestos a revolucionar el campo de las biomoléculas. Entre otros beneficios, estos artilugios de ‘usar y tirar’ evitan el costoso proceso de limpieza al que tienen que someterse las herramientas reutilizables y, por tanto, acelera el proceso de investigación.

4) Un concurso de investigación: Quizás una de las ideas más ‘rompedoras’ sea la de Innocentive, que ofrece la posibilidad de participar en un concurso de investigación. En su sitio web se exponen una serie de retos científicos, agrupados en distintas disciplinas, y quién logre solucionarlos opta a un premio valorado en un millón de dólares. “Tu solución de hoy podría contribuir a los grandes avances del mañana”, sostiene la compañía.

5) Órganos artificiales: Tengion, por su parte, está centrada en fabricar órganos a partir de células extraidas de los seres humanos susceptibles de recibir un trasplante. “La razón por la que nos levantamos todas las mañanas es que cada 30 segundos se produce una muerte por fallo orgánico”, declara Steven Nichtberger, presidente de la compañía. El primer órgano que han sido capaces de reproducir ha sido la vejiga, siempre partiendo del tejido de los propios pacientes. “La exitosa implantación de vejigas artificiales en siete niños, a los que se les realizó un seguimiento de dos a cinco años apareció publicada en la revista ‘The Lancet’ en 2006”, presume Nichtberger. Pero éste sólo es el primer paso dado por Tengion. Tal y como apunta Forbes, los investigadores trabajan día a día para poder fabricar otros órganos: riñones, corazones, hígados e incluso nervios y vasos sanguíneos.

6) Robots auxiliares: Los robots diseñados por Aethon también están destinados a ocupar un lugar en la medicina del futuro. Sus creadores recalcan su valor a la hora de liberar de trabajo rutinario a los trabajadores de los hospitales: pueden recoger las bandejas de comida, ir al almacén a por vendas o repartir los medicamentos por las distintas habitaciones.

7) Secuenciar el genoma en tres horas: Pacific Biosciences es la responsable de la séptima tecnología, que ofrece “un nuevo paradigma para el análisis completo del genoma”. Se trata de una máquina que identifica las cadenas de ADN y las secuencia a gran velocidad, lo que “acelera la carrera por conseguir poderosas curas”. La empresa pretende reducir a tres horas los tres años que se tarda actualmente en desentrañar el genoma de un ser humano.

Genoma y 3º mundo

21 enero, 2012

¿CUANDO EL 3º MUNDO TENDRÁ SU GENOMA?
El Proyecto del Genoma Humano es el resultado de US$3.000 millones gastados en investigación y 10 años de trabajo de unos 3.000 científicos de 20 institutos de seis países del mundo.

Secuenciación de ADN

Un genoma humano tiene unos 3 millones de variantes en el ADN.

———————————–

Hace doce años, en el 2000, Bill Clinton y el entonces primer ministro británico Tony Blair anunciaron que se había completado el primer borrador del genoma humano y lo donaron a la humanidad. Contar con este “mapa genético” del ser humano abre una nueva era en la medicina personalizada, con nuevas formas de diagnosticar y tratar enfermedades. Esa información podría ser utilizada en el futuro por un médico para analizar qué enfermedades estaban escondidas en sus genes y desarrollaría ese individuo. Más de una década después, esa promesa sigue siendo un sueño en el 3º mundo. Los científicos propusieron que cuando un paciente fuera diagnosticado con la enfermedad se extraería una pequeña muestra del tumor y su código genético sería analizado para recomendar el tratamiento más efectivo. Este objetivo se ha cumplido a medias. Por ejemplo, en el tratamiento de cáncer de mama en el que ya se han identificado fármacos específicos para ciertos genes. Pero aún falta mucho para que estos avances lleguen a todos los paises y pacientes y no se queden sólo en aquellos pocos paises desarrollados, donde se están utilizando.

Secuencia de ADN
——————————–
Y es que uno de los mayores desafíos de la genómica y la medicina personalizada será vencer la mentalidad atrasada de los políticos del 3º mundo, Ello debido a que la educación no enseña al habitante común, luego devenido en político, la importancia de este tema sobre su vida personal y la sociedad. El costo, tanto en términos de tiempo como dinero, de la secuenciación del ADN sigue poniendose como excusa en esos lugares, pero no es real. Igual a como sucede con las computadoras e internet. Vaya como ejemplo el dato de que el nuevo secuenciador de genes, del tamaño de una impresora láser, tiene un costo de US$149.000. En estos paises, que detentan sistema económicos socialistas encubiertos, es decir, un politico asigna los factores de producción (tierra-trabajo-capital-capacidad empresaria) lo cual es socialismo, pero ellos encubren la realidad, llamandolo modelo de asignación de recursos u progresismo ó cualquier otra palabra que nada signifique. La realidad es que cualquier jugador de futbol, director técnico, artista ó politico gana esa cantidad de dinero en unos 2 meses. El problema es que como no hay inversores reales, debido a que son economias dudosas que viven pisoteando el derecho de propiedad y obstaculizando las inversiones y la competencia, es muy dificil que esto llegue a la gente común.

Banco de genes

Ya se sabe que la única manera de que lo más nuevo llegue a la gente, de manera más barata, es que haya una economia de libre mercado que permita la entrada y salida de bienes y la competencia, ambas cosas son odiados por los politicos del 3º mundo, y por ello estos sistemas prohiben ambas aduciendo que quita trabajo a la población (??).

————————————
Esta secuenciación de genes incluye los métodos y tecnologías que se utilizan para determinar el orden de toda la información que contiene una molécula de ADN. Aunque se ha avanzado a pasos enormes en este campo, todavía sigue siendo lento y costoso para estos paises. El doctor Jonathan Rothberg, quien inventó el aparato, llamado Secuenciador Ion Proton, predijo que éste podrá ser utilizado en una variedad de entornos médicos, incluidos hospitales infantiles, para observar si un recién nacido tiene un trastorno genético conocido o analizar la gran variedad de genes asociados a enfermedades como el autismo. Por primera vez será económico llevar a cabo la secuenciación de todo un genoma para abordar estos problemas, explica el científico. “Ahora podremos mirar todos los 6.000 millones de letras (de ADN humano). Existe la creencia firme de que mirando el todo seremos capaces de entender algunas de estas enfermedades crónicas” agrega. Si consideramos que el primer borrador del genoma humano tardó 10 años, el avance hasta ahora, doce años después, ha sido extraordinario.
———————————-
Los científicos que participan en el proyecto global para catalogar las diferencias en el ADN humano afirman que lograron trazar el 95% de todas las variantes. El llamado Proyecto Genoma 1000 tiene como objetivo secuenciar y comparar el ADN de 2.500 individuos de todo el mundo. Los resultados, sugieren que cada uno de nosotros tenemos en promedio unas 75 variantes que podrían jugar un papel en las enfermedades heredadas. Los resultados preliminares ofrecen información sobre enfermedades y tratamientos. Sólo identificando las diferencias en nuestra formación genética se podrá entender por qué algunas personas son más susceptibles a las enfermedades heredadas o a otros trastornos genéticos. Cada vez es más factible secuenciar sistemáticamente a muchas personas para encontrar variantes genéticas y establecer un catálogo que podremos utilizar como base de investigaciones sobre enfermedades.
———————————–

Cromosomas humanos

El genoma humano incluye las instrucciones de unos 20.000 genes y esta formado por unos 3.000 millones de pares de bases de ADN, “empaquetados” en 23 pares de cromosomas que se encuentran en cada una de las células de nuestro organismo. Unos tres millones de esos pares de bases varían de persona a persona. Y estas variaciones, llamadas polimorfirmos de un solo nucleótido o SNP, son las que los científicos están tratando de identificar. Los investigadores creen que ya lograron catalogar 95% de todos los SNP que se encuentran en los humanos. Ya logramos identificar más de 15 millones de diferencias genéticas estudiando a 179 personas. Los resultados revelan que cada individuo, en promedio, tiene unas 75 variantes que han sido previamente implicadas en enfermedades heredadas y entre 250 y 300 que podrían resultar en algún tipo de pérdida de funciones. El trabajo del Genoma 1000 continúa y todos los datos que se han obtenido hasta ahora serán puestos en internet para disposición de todos los científicos.
———————————–

Secuencia de ADN

Estamos aún en los primeros pasos de esta revolución, pero las posibilidades son enormes. La aplicación a la medicina moderna de los conocimientos genéticos que estamos acumulando cambiará radicalmente la forma como afrontamos la mayoría de las enfermedades. Es claro que el genoma humano es mucho más complicado de lo que se pensó. Es indudable que ha habido avances y que se ha podido establecer marcadores de susceptibilidad a algunas enfermedades pero estamos aún lejos de cumplir con todas las expectativas que se generaron. Es como que tenemos el mapa de los ladrillos con los que estamos construidos (lo que nos hace iguales), el problema está en las instrucciones (lo que nos hace diferentes), que se seleccionan de acuerdo a razas, poblaciones, medio ambiente, etc.

Los resultados publicados en ‘Nature’ y ‘Nature Genetics’ por el Consorcio Internacional del Genoma de la presión arterial, los estudios de asociación representan un gran avance en nuestra comprensión de las influencias heredadas de la presión arterial y ofrecer nuevos objetivos terapéuticos potenciales para prevenid las enfermedades del corazón y accidente cerebrovascular, que es la principal causa de muerte en el mundo. Ha descubierto 16 regiones genéticas nuevas que influyen en la presión arterial. En el estudio de colaboración internacional participaron 351 científicos de 234 instituciones con sede en 24 países de todo el mundo. Analizaron datos de más de 270 000 personas para encontrar las variaciones genéticas en el ADN de cada persona que se asocia con presión arterial alta o más baja. Permitió identificar 16 regiones genéticas nuevas y la confirmación de las 12 regiones del gen ya conocidas. Tambien mostró que los efectos genéticos sobre la presión arterial son similares en las personas de Europa, Asia oriental, Asia meridional y África ascendencias.
———————————-

El proyecto de los 1000 genomas

6 noviembre, 2010

En este proyecto (‘The 1000 Genomes Project’ en inglés) lanzado en 2008, participan varios centros de investigación de EE. UU., el Reino Unido, Dinamarca, Alemania, Finlandia, China, Corea del Sur, Francia y Suiza. Su principal objetivo es determinar más del 95% de las variedades genéticas que se encuentran por los menos en el 1% de las personas que pertenecen a los cinco principales grupos de población.

Foto:National Human Genome Research Institute

Foto:National Human Genome Research Ins

La iniciativa se prolongará por 3 años en dos fases y costará alrededor de 30-50 millones de dólares (entre 20 y 35 millones de euros). Los resultados que ya ha arrojado el trabajo, que ha identificado hasta ahora 100 regiones del genoma relacionadas con el riesgo a sufrir enfermedades como la diabetes, la degeneración macular asociada a la edad, o los tumores de próstata y de mama.

El proyecto genoma humano costó 1.000 millones de dólares (711 millones de euros) e implicó a miles de investigadores de todo el mundo durante una década. El genoma de Watson se secuenció en medio año y costó un millón de dólares (711.000 euros). Luego fue posible descifrar un genoma completo por 35.000 euros en un mes. Y ahora costará la quinta parte y se podrá hacer en una semana. Ya hay empresas estadounidenses preparadas para ofertar el mapa del genoma por mil dólares (unos 700 euros y en el 2020 será tan común como una radiografía hoy.

En 3 años vamos a lograr 60 veces más información que la que se ha depositado en las bases públicas de ADN en los últimos 25 años. Ya no se trata, explican los especialistas, de descifrar el genoma humano, es decir, de los 3.000 millones de bases y decenas de miles de genes que componen el ‘libro de la vida’; sino de desvelar las claves que diferencian a un individuo de otro.

Para esto, se planea hacia el 2012 secuenciar los genomas de más de 2.500 personas. Es una meta muy ambiciosa, dado que por primera vez el genoma de un ser humano fue leído hace menos de diez años y hace poco el número de los genomas secuencionados no superaba las varias decenas.

Cuandose tengamos el catálogo completo de mutaciones de los 50 cánceres seleccionados, el diagnóstico podrá ser mucho más preciso y precoz, con lo que mejorarán las oportunidades de los pacientes.

El resultado de la primera fase del proyecto son 179 genomas de habitantes del Estado Utah, EE. UU., chinos de Pekín, japoneses de Tokio, así como miembros del pueblo nigeriano yoruba. Asimismo fueron secuencionados 8.140 fragmentos genéticos de 697 personas de Europa, Japón, EE. UU., China, Kenia y Nigeria.

Según informó el coautor del proyecto, Richard Durbin, del Instituto Wellcome Trust Sanger en Hixton, Reino Unido, desde hace menos de dos años los investigadores lograron identificar más de 15 millones de variaciones genéticas, de las cuales cerca de 8 millones no se conocían: “Es el mayor catálogo de datos genéticos y tiene acceso libre, para ayudar a aumentar la efectividad de las investigaciones genéticas”, subrayó el científico.

Los datos sugieren que cada persona tiene unas 75 variantes genéticas relacionadas con desórdenes heredados. Este catálogo de las modificaciones genéticas será una base para un estudio profundo de los vínculos entre las peculiaridades genéticas y el riesgo de ciertas enfermedades en cada persona (por ejemplo, la tendencia a la obesidad o el elevado riesgo de drogadicción). Será el comienzo de una nueva era en la genética y la medicina.

Muchos afirman que la especie humana se podría manipular a sí misma en futuro no muy lejano.

Un poco de historia:

2003 El consorcio internacional, formado por científicos de seis países, descifra la secuencia completa del genoma humano. Y a partir de ahí…

2005 La compañía Life Sciences (EEUU) desarrolla una tecnología para descodificar el ADN de forma más rápida y económica. EEUU selecciona 13 especies de animales para secuenciar su genoma. La secuencia del genoma del chimpancé muestra que comparte un 96% con el humano.

2006 Se descubre que los neandertales y humanos modernos comparten el 99,5% de su genoma. Un grupo de científicos observa que el material genético de cada humano es diferente.

2007 James Watson, el ‘padre’ del ADN, secuencia su genoma. Venter también se secuencia a sí mismo. ‘Nature’ se hace eco del proyecto ENCODE, que analiza todos los elementos del genoma, y del mapa de las diferencias genéticas.

2008 Secuencian por primera vez el genoma del cáncer de un individuo. Aterrizan los mapas genéticos de la salud y se conocen los de los dos cánceres más mortales.

2009 Proliferan los análisis genéticos personalizados. El genoma humano, hito científico de la década. Un coreano se convierte en la quinta persona en descifrar su genoma.

2010 El genoma de la soja abre una nueva puerta al cultivo de biocombustibles.
Secuencian el genoma de un humano de hace 4.000 años y el de una familia. Se publica que los humanos modernos heredaron hasta un 4% de su ADN de los neandertales.

A %d blogueros les gusta esto: