Posts Tagged ‘ciencia’

IMPORTANCIA DE VIVIR EN EL SIGLO XXI

11 diciembre, 2015

 

La Importancia de manejarse con Información y Conocimientos Ciertos en la vida …

Sourced through Scoop.it from: www.dailymotion.com

Vivir con la mente en el siglo XXI es importante para la sociedad y cada uno de nosotros…….

See on Scoop.itNovedades Cientificas y Médicas

EL UNIVERSO, LA CIENCIA Y USTED

28 noviembre, 2015

¿Qué relación hay entre usted, la ciencia y la forma en que vive su día a día?…la sociedad humana es sólo una suma de usteds…

Sourced through Scoop.it from: www.youtube.com

See on Scoop.itNovedades Cientificas y Médicas

Terapia Génica antienvejecimiento

21 octubre, 2015

USANDO TERAPIA GÉNICA CONTRA EL ENVEJECIMIENTO
——————————————————————————-
En mamíferos, reducir la miostatina o aumentar la folistatina (que inhibe la producción de miostatina) se puede hace de varias formas, entre ellas con la terapia génica para la interferencia de ARN. Esto lleva a un aumento del crecimiento muscular, menor cantidad de grasa corporal y en ratones, al menos, una posible pero modesta extensión de la vida. La forma más directa es apagar el gen de la miostatina y es el camino elegido por investigadores chinos en trabajos con perros, usando CRISPR-Cas9, que es una forma de edición genética que es particularmente barata y precisa.
———-
Hay por lo menos una raza de perros en el que se ha producido una mutación natural del gene de la miostatina, e igual pasó con vacas, ratones (se llamaron ratones schwarzenegger), cerdos e incluso humanos, actualmente vivos y musculosos, como sus compañeros animales. La idea detrás es que la producción muscular mejorada es una terapia viable para para evitar problemas musculares conocidos y la sarcopenia, que es la pérdida progresiva de masa muscular y fuerza que se produce con el envejecimiento. Liz Parrish uso la folistatina o FS344 para actuar sobre la miostatina, lo que aumenta la masa y la fuerza muscular. Esto ha sido probado en pacientes con distrofía muscular.
———-
Es interesante contar que la empresa Bioviva, cuyo CEO es una mujer de 45 años, Liz Parrish, quién el 15 de septiembre, públicamente reconoció haber realizado una terapia génica de follistatina sobre ella misma, junto con otra alteración para evitar el acortamiento de telómeros: actuando sobre el gen mTERT, el cual en ratones de 1 año les alargó la vida un 24 % y en ratones de 2 años fue del 13 %. Lo hizo para adelantar los ensayos clínicos con humanos y los tratamientos dirigidos a frenar o revertir los efectos del envejecimiento. Como actuar sobre los genes esta prohibido en EE.UU. por la FDA, ella viajó a Colombia para hacerlo.
———-

See on Scoop.itNovedades Cientificas y Médicas

Como usar los datos en medicina

6 septiembre, 2015

El Aprendizaje automático y la ciencia de Datos van a Hacer Más pára Mejorar la Salud de TODAS LAS CIENCIAS BIOLÓGICAS Combinadas.

Sourced through Scoop.it from: singularityhub.com

LA IMPORTANCIA DE USAR DATOS EN MEDICINA ¿Cuál es la gran idea?

—————————————————–
Su genoma consta de aproximadamente 3.2 mil millones de pares de bases (el ADN) que codifican literalmente tu yo, es decir, toda tu persona. Su código de genes determina las enfermedades que podría tener, si es bueno en matemáticas o con la música, como será su memoria y cuan buena es, cómo te ves fisicamente, como te sientes, cuánto tiempo es probable que vivas y muchos más datos. Esto significa que si podemos descifrar este código genómico podemos predecir su futuro biológico y trabajar para anticipar y mejorar su salud.
—————
Es un problema de datos – y si usted es un científico de datos o experto de aprendizaje de máquinas- esto será el problema más interesante e importante que podría tratar de solucionar. En términos más simples, secuenciar un genoma significa convertir el ADN en una serie de cuatro letras que se parece a esto:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Y ese genoma es un archivo de texto de unos 300 gigabytes.
————–
Al comparar su genoma secuenciado con millones de genomas de otras personas y el conjuntos de datos de los servicios de salud, podemos usar la máquina de aprendizaje y técnicas de minería de datos, para correlacionar ciertos rasgos (color de los ojos, lo que su cara parece) o enfermedades (Alzheimer, Huntington, etc.) a ciertos factores en los datos y comenzar a desarrollar diagnósticos/terapias personalizadas. Manipular los datos biológicos es como un problema de traducción, como el Google Translate. La base de datos biológicos es HLI, y todo el mundo entra en ella. Los conjuntos de datos creados incluyen lo siguiente:

Genómica: Los 3.2 mil millones de nucleótidos de madre igual de su padre.
Microbioma: El genoma de los 100 billones + microorganismos de nuestro cuerpo.
La MRI/Imagenología: imágenes detalladas del cerebro, los órganos y el cuerpo.
Metabolome: Los 2.300 moléculas en el torrente sanguíneo.
Datos de Salud Fisiológica: Todos los datos de nosotros mismos: signos vitales, niveles de glucosa en sangre, los micro ARN en la circulación sanguínea, la frecuencia cardíaca, VO2 …
Si traducimos todos estos datos obtendremos un resulado de tu salud. Similar a cómo Google Translate actúa.
—————-
El Traductor de Google (GT) usa un proceso llamado traducción automática estadística, lo que significa que GT genera traducciones basadas en patrones que se encuentran en grandes cantidades de texto escrito. En vez de enseñar a la computadora todas las reglas de todos los idiomas, este enfoque permite que ella descubra las normas por sí misma en base a los patrones estadísticos significativos en los datos. Una vez que halla estos patrones, puede usar este “modelo” para traducir el texto similar en el futuro. Asi traduce en 90 idiomas diferentes. El reto ahora es usar lo mismo con la Genética, los registros de salud, y nos encontramos a la persona perfecta para liderar este esfuerzo: Franz Och – el hombre responsable de la construcción de Google Translate. “La gran misión es aprender a interpretar el genoma humano y ser capaces de predecir cualquier cosa que nos pasa a partir del código fuente”.
—————-
HLI está buscando ahora mismo lo siguiente: fuertes ingenieros de software que pueden construir de alta calidad, software fiable y de alto rendimiento, Expertos de aprendizaje automático y Estadísticas expertos. Aqui puede aplicar: http://www.humanlongevity.com/careers/open-positions/

ñada su visión …

See on Scoop.itNovedades Cientificas y Médicas

La evolución hoy

18 agosto, 2015

EL PAPEL DE LA EVOLUCIÓN HOY
————————–
Parece lógico pensar que la sabia evolución, la cual sólo se preocupó de mantenernos sanos, con el objetivo de lograr la reproducción mas óptima y así, en teoría, lograr el mejor producto para la próxima generación venidera, fue todo un éxito. Asi logramos conseguir y garantizar la mejor evolución de nuestra especie, como tal. El papel de la evolución en todo este lento desarrollo como especie, fue esencial, simple y efectivo. Así la evolución nos llevó a producir los Galileos, Newton, Einstein, Darwin, etc. que nos pusieron a la altura de la ciencia que hoy ya conocemos. La frutilla de esta torta evolutiva fue puesta por la aparición y desarrollo de dos áreas que cambiaron las reglas: 1) la Genética en la biología posibilitó trascender a la evolución o manipularla y 2) el avance de la computadoras y la Inteligencia artificial que nos catapultan en el manejo de datos, rapidez y eficiencia de los conocimientos.
————
Llegados a este punto, donde nos es posible programar una biología humana mejor a la que ya tenemos, sin la necesidad de recurrir a los millones de años que tuvimos que invertir con la evolución natural para llegar al punto en que estamos. Es claro que ahora, el proceso de nacer, crecer, reproducirnos y morir, parece haber dejado de tener un sentido o necesidad racional, a nivel biológico. La muerte ahora más bien, representa una demora en ese proceso de evolucionar: dejó de ser necesaria, como tantas otras cosas que la ciencia nos ha enseñado. A su vez, la Inteligencia Artificial en el área de la computación, ha mostrado el mejor camino para aprender más rápido y sin los errores humanos que tuvimos que superar en el pasado. Los algoritmos computacionales nos permitirán usar toda la información que ya tenemos y también la información futura que produzcamos y podremos sacar de ella, todas las conclusiones que necesitamos.
————
Esto era impensables hace unas pocas décadas. Pero hoy, todo parece indicar que ya sólo hace falta tomar consciencia de lo aqui expuesto y aplicar los recursos necesarios para obtener un desarrollo adecuado. El futuro próximo puede ser completamente distinto a lo que todos hemos creído. ¿Cuánto demoraremos en identificar el rumbo correcto y encender los motores?. No lo sabemos. Nuestra sociedad es un poco confusa aún y los medios de comunicación, manejados en su gran mayoría con criterios comerciales, no tienen suficientes conocimientos para manejar estos temas en el corto plazo. Es probable que, tal como ocurriera en el pasado, debamos esperar unas cuantas décadas de confusión y desvíos, para que al final, la sociedad en su mayoría, vislumbre hacia adonde ir y termine apoyando todas estas cuestiones. No será fácil ni rápido y estará plagado de anuncios apocalípticos, como todos los grandes cambios.
————
REF (ago 2015)

See on Scoop.itNovedades Cientificas y Médicas

Sepa como Envejece

7 abril, 2015

TENGA IDEA DE COMO ENVEJECE EL SER HUMANO
————————–
Cada vez vivimos más y en mejores condiciones, pero el proceso de envejecimiento comienza mucho antes de lo que imaginamos. La mayoría de los cambios vienen por el sedentarismo y mala alimentación. Otros son debido al desgaste celular que no reponemos. Un mejor conocimiento del envejecer, implica verlo como un proceso, para poder entender el radio de acción que tenemos hoy para llevar a cabo una vida con mayor calidad. El ritmo, los momentos y el como dependen de cada persona, de lo que ella haga día a día, de lo que sus padres y abuelos hicieron también durante su vida (herencia genética y epigenética).
———–
En general, podemos afirmar sin equivocarnos que las personas no son conscientes más que de los cambios más obvios (no pueden leer o van al baño muchas veces, etc.) pues en general, la persona media no sabe ni siquiera cuantas veces late su corazón por minuto, debido a que han sido criados y educados desconociendo toda esta información importante (ritmo cardiaco, colesterol, presión sanguinea, etc.) e incluso, en muchas culturas muy machistas, era un sintoma de debilidad o poca masculinidad el mostrar interés por estos temas. Hoy, tenemos otra visión sobre estos temas e incluso otra tecnología que nos ayuda: aparatos baratos y fieles que miden esos datos y en la comodidad de nuestras casas.
————-
He aqui un resumen de los cambios que se van produciendo con los años.

A LOS 18: 

– PIEL: LA PRODUCCIÓN DE COLÁGENO Y ELASTINA BAJA UN 1% AL AÑO: desde esta edad. La piel se vuelve más fina, pierde elasticidad, se seca más y se rasga con más facilidad. La persona no nota nada al principio, pues nuestra vista no es de lo mejor.

A LOS 20 AÑOS:
– CEREBRO: LA CANTIDAD DE NEURONAS COMIENZA A DESCENDER: Nacemos con más de 100.000 millones de neuronas, número que comienza a reducirse a los 20 años.

A LOS 25:
– PULMONES: DISMINUYE NUESTRA CAPACIDAD AERÓBICA a un ritmo de 10% cada diez años, o aún mayor, dependiendo de cuanto sedentarismo practiquemos.

A LOS 30:

– PIEL: LLEGAN LAS PRIMERAS ARRUGAS Especialmente en la zona de los ojos.
– RIÑONES: EMPIEZAN A FILTRAR PEOR LA SANGRE. Desciende el número de células, secretan demasiada agua y muy poca orina.
– HORMONAS: DESCIENDE GRADUAL LA PRODUCCIÓN DE TESTOSTERONA a un ritmo del 1% anual y esta hormona afecta muchas cosas, incluso hasta la personalidad.
– PULMONES: PIERDEN CAPACIDAD DEL 1% AL AÑO A PARTIR DE LOS 30. Se debilitan los músculos, desciende el número de alvéolos y obtenemos menos oxígeno del aire respirado. Son las primeras muestras del sedentarismo y sus efectos físicos.
– MUSCULATURA: COMIENZA A DISMINUIR LA MASA (Y FUERZA) MUSCULAR la que se reducirá más de un 10 al 25% en toda nuestra vida adulta. Otra consecuencia variable con nuestro nivel de sedentarismo.

A LOS 35: 

– EMPEZAMOS A PERDER CAPACIDAD AUDITIVA y a poner mayor volumen a radios, TV y al hablar más fuerte.
– LOS HUESOS EMPIEZAN A PERDER MASA ÓSEA a un ritmo del 1% al año. También influye el sentarismo.
– DESCIENDE LA FERTILIDAD. Baja el número y la calidad de óvulos y del esperma.

A LOS 40:

– CEREBRO: Pierde unas 10.000 NEURONAS al día lo que afecta a la memoria, coordinación y funciones superiores.
– ENCÍAS: retrocede levemente y los dientes se exponen más a restos de alimentos, también se desgasta el esmalte.
– EMPEZAMOS A PERDER ESTATURA (1 cm cada década). Los discos que separan las vértebras se estrechan, podemos llegar a perder entre 2,5 y 7,5 cm de estatura.
– VISTA: DE CERCA DISMINUYE pues la lente se vuelve más rígida, y cuesta enfocar objetos a menos de 60 cm.
– PIEL: ARRUGAS MÁS MARCADAS (LABIO SUPERIOR). La capa de grasa es más delgada, favorece la formación de arrugas y nos hace más sensibles al frío.
– CORAZÓN: MENOS Y MAYORES CÉLULAS MUSCULARES DEL CORAZÓN. El corazón tarda más en llenarse, las arterias se vuelven más rígidas y aumenta la tensión arterial.

-METABOLISMO: COMIENZO DE LOS PROBLEMAS DIGESTIVOS provocados por la mala dieta.

 A LOS 50: 

– OIDO: NOS CUESTA ESCUCHAR TONOS AGUDOS. Más difícil distinguir palabras.
– SENTIDOS: Disminuye el olfato y el gusto lo que afecta más a sabores salados y dulces que a los amargos o agrios. Esto puede aumentar el consumo de alimentos no saludables con exceso de sal o azucar.
– MENOS NEFRONAS, los riñones pierden capacidad de filtrado.
– METABOLISMO: Aumenta el nivel de azúcar en sangre, en ayunas: entre 6 y 14 mg/dL cada década.
– AUMENTA EL TAMAÑO DE LA PRÓSTATA, pasandose de ser una nuez/avellana al tamaño de una mandarina.
– VISTA: Ojos más secos. Podemos ver “moscas” por la solidificación de los fluidos.
– PIEL: Continua su decadencia y las arrugas son ahora más profundas. Aparecen las manchas de la edad, pues hay peor gestión del calor y cicatrización más lenta en la piel.
– EDAD MEDIA DE COMIENZO DE LA MENOPAUSIA: Se contraen ovario y útero, los tejidos de la vagina son menos elásticos y más secos.
– PÉRDIDA MÁS ACELERADA DE DENSIDAD ÓSEA POR LA MENOPAUSIA. Sobre todo en la cabeza del fémur, en las muñecas y las vértebras.

– PROBLEMAS DE ULCERAS, ACIDEZ, HERNIAS ESTOMACALES, ETC. debido a la mala dieta se pueden ver en un 50 % de hombres y mujeres.

 A LOS 55: 

– DEL 10 AL 25% DE LOS HOMBRES BAJA SU NIVEL DE TESTOSTERONA, lo cual provoca menos esperma, baja la libido, menor flujo sanguíneo al pene (erecciones más cortas o menos rígidas, mayor riesgo de impotencia).
– LOS HOMBRES GANAN PESO HASTA LOS 55. A partir de esa edad comienzan a cambiar la forma fisica de piernas, pecho, brazos debido al aumento notable de la grasa y perdida muscular.

-DISMINUYE LA CAPACIDAD CEREBRAL DE ANALIZAR: debido a que la memoria, la atención y la percepción fina de los cambios se van perdiendo. Hay tendencia a sufrir ansiedad, depresión y adquirir o apuntalar adicciones con las comidas, bebidas , etc.

A LOS 60:
– DESCIENDE EL NÚMERO DE CÉLULAS EN LA MÉDULA ESPINAL. No afecta a nuestra fuerza ni a nuestra sensibilidad.
– VEMOS PEOR CON LUZ TENUE. Una persona de 60 años necesita 3 veces más luz que una persona de 20 años, la lente es más densa, deja pasar menos luz.
– LAS VELLOSIDADES INTESTINALES SE “ALISAN”. Se absorben menos nutrientes, el movimiento es más lento y es más probable sufrir estreñimiento.

-LA TEMAS DE MEMORIA Y RELACIÓN DE COSAS SIGUE PERDIENDO CALIDAD

A LOS 65:

– PÉRDIDA GRADUAL DEL OÍDO.

– MAYOR RIESGO DE EROSIÓN Y PÉRDIDA DE DIENTES.
– AUMENTA EL RIESGO DE PADECER ENFERMEDADES CARDIOVASCULARES (ictus, infartos, etc.)
– SE REDUCE LA CELULARIDAD DE LA MÉDULA. Cuando nacemos el 80-100% de la
médula ósea está compuesta por células hematopoyéticas, a los 65 años sólo el 50%.
– RIESGO DE PADECER CATARATAS.
– LA MENOPAUSIA CONTRIBUYE A LA INCONTINENCIA. La falta de estrógenos hace que se debiliten los tejidos de la uretra y ello lleva, tanto en hombres como mujeres a tener olor a orin en su ropa interior (antes llamado “olor a viejo”).
– LAS MUJERES GANAN PESO HASTA LOS 65. Y luego empiezan a perderlo, el músculo magro es reemplazado por grasa.

A LOS 70: 

– CAMBIOS EN LA PERCEPCIÓN DE LOS COLORES. La lente se amarillea, los colores pierden brillo y es más difícil ver los contrastes.
– MENOR CAPACIDAD PULMONAR. Un hombre de 70 años inhala medio litro de aire en una bocanada, la mitad que uno de 30. El efecto varía de acuerdo al sedentarismo que viva la persona.
– INCONTINENCIA URINARIA. Una persona de 70 años tiene la mitad de capacidad que una persona de 30 años. El típico olor a viejo o vieja (orin en la ropa interior) se intensifica por estos motivos si la persona no presta atención a ello.
– SE REDUCEN SUTILMENTE ALGUNAS TAREAS MENTALES. vocabulario, memoria a corto plazo y la habilidad de aprender sufren las consecuencias.
– EL HÍGADO SE HACE MÁS PEQUEÑO. Sus células, con gran capacidad de regenerarse, son cada vez menos y su trabajo pierde eficacia, los efectos de los fármacos se vuelven más duraderos.

A LOS 75:
– PÉRDIDA DE VISIÓN PERIFÉRICA. Entre los 70 y los 80 años perdemos entre 20º y 30º de visión periférica.

– LOS RIÑONES ya filtran la mitad de sangre que una persona de 30 añós.
– UN 30% DESARROLLA MÁS CARIES DE RAÍZ.
– MAYOR PROPORCIÓN DE GRASA MUSCULAR. Proporcionalmente se tiene 2 veces más grasa que al principio de la vida adulta, la que se distribuye de otra manera y cambia la forma del torso.

A LOS 80:

– DIFICULTAD PARA DISTINGUIR SOMBRAS Y PERCIBIR LA PROFUNDIDAD.
– LAS OREJAS Y LA NARIZ NUNCA DEJAN DE CRECER. Las orejas crecen a un ritmo de 0,22 mm por año lo que es mas o menos 1cm en 50 años.
– EL 50% SUFRE PÉRDIDAS DE AUDICIÓN.

———————–

Las diferencias en las esperanza de vida, si se mira bien son mínimas. ¿Cuánto más vive un japones que un Argentino?. Pongamos que 7 años en promedio, como mucho y unos 4 años más que un norteamericano. Todo muestra que hemos llegado a un techo y para superarlo, necesitamos una visión diferente del tema. Es claro que la vejez es dañina e implica cambios en el metabolismo que conducen a un deterioro progresivo del cuerpo. Pero esos daños, quizás se puedan reparar dentro de un tiempo. Con mejor mantenimiento, hoy ya podemos permanecer más tiempo saludables. Esto es facil de comprender.
—————–
Los daños basicamente se producen por las mutaciones nucleares y mitocondriales a nivel celular. La especie de basura molecular que va produciendo el metabolismo, tanto en el interior como exterior de las células son posiblemente causantes de problemas (Alzheimer, problemas inmunes, diabetes, etc.). También la pérdida de la elasticidad de las conexiones celulares también tienen su efecto. El medio ambiente en que vivimos y nuestros hábitos diarios también hacen su parte. La ciencia siempre a ido en contra de la naturaleza: el auto nos impide caminar, las vacunas nos impide enfermarnos, etc. Esa es la base de nuestro progreso científico y la que nos permite vivir vidas más largas y plenas hoy. Renegar de ello no tiene sentido, asi como cuestionarlo.
—————–
Es claro que el cerebro está hecho de la misma materia que el resto del cuerpo: esto es celulas y más celulas. Si nuestro cuerpo se mantiene mejor o logra rejuvencer, también lo hará nuestro cerebro. A las personas normales, siempre les va a resultar mucho mejor vivir entre una población activa y sana que hacerlo en sociedades envejecidas y enfermas. La vejez es una masacre, dijo alguna vez Woody Allen. Creo que tenía razón.
—————–

See on Scoop.itNovedades Cientificas y Médicas

Los negadores de la Ciencia

6 marzo, 2015

LOS NEGADORES DE LA CIENCIA
—————–
Los argumentos actuales contra los avances de la ciencia van desde el peligro de construir robots, aumentar la inteligencia artificial IA, los peligros de seguir investigando los genes, de comer organismos modificados geneticamente, de crear armas geneticas, etc. etc. etc. Todos los argumentos valen, al igual que ocurría con los religiosos del pasado, que esgrimían la biblia y el látigo enfadado del ser supremo, para entorpecer los avances cientificos. A ellos no les gusta aceptar que somos primates definidos por un código genético, al igual que los robots actuales que fabrican autos, que son maquinas que estan manejadas por un programa o software instalado en una computadora o chip. Por algún motivo esto les lastima el ego y manifiestan que no puede ser que tengamos estos antecedentes tan humildes: venir de un mono y tener un cerebro defectuoso es terrible para ellos, que sueñan con dioses y poderes divinos. Si aceptamos la realidad, la pregunta de si existen hombres malos, tiene una respuesta simple, al igual que preguntarse si se puede eliminar la agresión innata existente.
——–
Claro que se puede hacer y en unos pocos años se hará, a pesar de toda la oposición de los que hoy son miopes acerca de las ventajas que nos traerá como sociedad humana, todos estos cambios. Es probable que, tal como predicen algunos hombres lúcidos sobre estos temas, en 2025 ya podamos copiar nuestro defectuoso cerebro a una computadora y es probable que ello se pueda hacer en un simple y viejo CD de 650 MB de capacidad, pues el cerebro humano, tiene sólo un poco más de desarrollo que el cerebro de un chimpance.
———
Por algún motivo, la gente se siente incluso agredida ante estos razonamientos, pues estas ideas nos coloca en un humilde lugar dentro de las especies animales existentes en el mundo. Estas ideas que van corroborando todos las investigaciones y descubrimientos que se producen en la ciencia, nos obliga a abandonar las histericas ideas mágicas de poderes antinaturales y designios divinos y eso, al parecer, nos pone locos. Pues, en realidad no deberíamos preocuparnos mucho por esto. Resultó al final, mucho mejor la realidad que estos inventos, pues nosotros, los humildes primates, podemos cambiar las cosas!. Es algo terriblemente optimista esta versión y mucho más justa que la versión religiosa.
———-
Luhan Yang, reclutada por Harvard en Pekín y que tuvo un papel clave en desarrollar la tecnología para editar ADN llamada CRISPR-Cas9, ha fundado una empresa llamada eGenesis para hacer ingeniería genética con los genomas de cerdos y ganado vacuno, introduciendo genes beneficiosos y editando los perjudiciales. ¿Algo de todo esto se puede hacer a los seres humanos?. Por supuesto que se puede. La línea germinal (en biología el óvulo y el esperma) que forma el embrión, pueden editarse y asi se podrían eliminar los genes con enfermedades y pasar esos cambios genéticos a las generaciones futuras, librarnos de azotes como la fibrosis quística. También se podrían instalar genes que ofrecen protección de por vida contra las infecciones, el Alzheimer y posiblemente que los efectos del envejecimiento. Pero habrá que luchar un poco contra todos esos grupos que se oponen a los avances cientificos con argumentos, religiosos o ambientalistas o grandes catastrofes.
———–
Para evitar los embates de estas organizaciones, el sistema es tan preciso que se espera que se convierta en un nuevo método para crear terapias genéticas para quienes sufren enfermedades. La idea es que los médicos puedan corregir directamente un solo gen con fallos, por ejemplo en las células sanguíneas de un paciente con anemia falciforme. Asi, este tipo de terapia genética no afectaría a las células germinales que tanto indigna a los opositores y los cambios en el ADN no se transmitirían a las generaciones futuras. Una decena de países, entre los que no se cuenta Estados Unidos, han prohibido la modificación genética de la línea germinal y sociedades científicas en todo el mundo han concluido de forma unánime que sería demasiado arriesgado hacerlo. La convención sobre derechos humanos y biomedicina de la Unión Europea afirma que modificar el patrimonio genético sería un crimen contra “la dignidad humana” y los derechos humanos. Pero todas estas declaraciones se hicieron antes de que fuera factible cualquier tipo de ingeniería de precisión sobre la línea germinal. Ahora, gracias a CRISPR, es posible.
———–
CRISPR se descubrió hace apenas tres años pero los biólogos ya lo usan de forma generalizada como una especie de herramienta de búsqueda y reemplazo para alterar el ADN, incluso alteraciones de una única letra. La corrección de genes en el caso de enfermedades hereditarias graves será ampliamente aceptada por el público, pero más allá de eso la tecnología producirá un clamor popular porque “todo el mundo querrá un niño perfecto” y podría conducir a la posibilidad de escoger el color de ojos y, con el tiempo, la inteligencia. Estas son cosas de las que siempre hablamos. Pero nunca habíamos tenido la posibilidad de hacerlo, como existe ahora. El sistema CRISPR incluye una enzima que corta los genes y una molécula guía que se puede programar para atacar combinaciones únicas de las letras del ADN: A, G, C y T. Al introducir estos ingredientes en una célula cortan y modifican las letras deseadas.
———
Y para darle una idea a usted de donde nos encontramos en todo esto, digamos que en las reuniones de grupos que se conocen como grupos “transhumanistas”, que son las personas a las que les interesan los próximos pasos en la evolución humana, se muestra una diapositiva en la que aparecen listadas las variaciones naturales de alrededor de 10 genes que, cuando la gente nace con ellos, les dan cualidades extraordinarias o bien una resistencia a una enfermedad. Una hace que los huesos humanos sean tan duros que rompen un taladro quirúrgico. Otro cambio reduce drásticamente el riesgo de sufrir infartos. En las investigaciones de islandeses hallaron que una variante del gen para la proteína precursora amiloidea, o APP, se logra la protección contra el Alzheimer, pues las personas que la tienen nunca sufren demencia y siguen estando lúcidos hasta muy avanzada edad. Muchos creen que CRISPR se puede usar para tener genes mejores, que funcionaran como vacunas, no contra virus, sino contra las enfermedades genéticas más comunes.
———
Mientras tanto, los huesos del pasado siguen apareciendo y ratificando todo esto, de lo importante de seguir adelante. Es interesante saber que ya Sarmiento, cuando estaba en Chile, conoció a Darwin en su viaje por el pacifico. Intercambio ideas con él y estuvo completamente de acuerdo con su idea de la Evolución del hombre a partir del mono. Este encuentro fue escrito por él y también por Darwin, años despues. Observemos que un sanjuanino, hace 170 años, ya había comprendido la realidad de la teoria de Darwin, y usted hoy, esta dudando aún de toda su evidencia. De nada sirvieron todos los avances desde esa fecha a hoy para usted, pues sigue en el mundo falaz que se opone a la realidad.¿Cuál sospecha usted que es la causa de esto?.
———–

Grupo en facebook: https://www.facebook.com/groups/novedadescientificasmedicas/

REF

See on Scoop.itNovedades Cientificas y Médicas

Cumbre de Ciencia en Holanda (Nov 19-20)

2 noviembre, 2014

TEATRO DELAMAR- AMSTERDAM-HOLANDA  here’s an ancient Indian tale about a ruler who offered the inventor of chess any gift he desired. The sage gestured to a chessboard, “I’ll

Source: singularityhub.com

CUMBRE EN HOLANDA SOBRE CIENCIA REAL (UNIVERSIDAD SINGULARITY)
———————-
Singularity University presenta una Cumbre Europa, que es una conferencia de dos días en Amsterdam para explorar futuros, tecnologías que cambian el juego y sus implicaciones inminentes para las empresas y los empresarios. El lema es un Abrazo mañana, inicie hoy- se apliquelo ahora!. Hay un antiguo cuento de la India acerca de un gobernante que ofreció el inventor del ajedrez cualquier regalo que deseaba. El sabio hizo un gesto a un tablero de ajedrez, “Voy a tener un grano de arroz en la primera casilla, dos granos en la segunda, cuatro en la tercera, y así sucesivamente, hasta el final”. El gobernante, poco educados en matemáticas, concedió el deseo de la salvia y se llevó a la quiebra rápidamente. El arroz requerido habría abarcado todo y mucho más del que habia en el reino y. ¿Por qué?. Por que los 64 pasos lineales llegan a 64, pero los 64 pasos con duplicaciones lleva a 18 trillones de toneladas. El el poder del avance de la tecnología que no lo hace en forma lineal sino exponencial.
———————
“Cada uno de los teléfonos inteligentes es más poderoso que el superordenador más rápido del mundo de hace 20 años”, dice Kathryn Myronuk , la síntesis y la convergencia de plomo facultad de la Universidad de la Singularidad. “El costo de obtener el genoma secuenciado solía ser el equivalente a la compra de un equipo de fútbol, pero ahora es un buen lugar en la Copa del Mundo”. Con tecnologías de la información crece a un ritmo acelerado, como los granos de arroz del tablero de ajedrez, el poder disruptivo de la exponencial está infiltrando más industrias. Y a medida que el costo cae en picado, ya no hay que ser una organización gigante para hacer grandes cosas: pequeños equipos de personas están aprovechando la tecnología para crear empresas de mil millones de dólares, no en una década, pero la mitad de ese tiempo o menos. Instagram fue adquirido por $ 1.000 millones el mismo año fotografía gigante Kodak se declaró en quiebra. Este año, con 5 años de edad, WhatsApp fue adquirida por Facebook por $ 19.000 millones, y la aún incipiente virtual de la empresa Oculus, realidad virtual, fue por $ 2.000 millones.
——————-
“Estamos viviendo en un mundo donde un par de chicos o chicas en un garaje puede tocar mil millones de personas, y que nunca ha sido así antes,” dice Peter Diamandis , cofundador Singularity University y presidente ejecutivo y presidente y CEO de XPRIZE. De la Cumbre de Universidad de la Singularidad en Europa (Amsterdam, Noviembre 19-20) celebrará su facultad de líderes de opinión con los principales empresarios, ejecutivos y políticos de Europa para explorar el mundo de acelerar el progreso y descubrir las ideas y tecnologías a punto de perturbar los negocios y cambiar el planeta- incluso antes de lo que piensas. En dos días los participantes Cumbre Europa aprenderán de los principales pensadores y hacedores cómo va la robótica, la inteligencia artificial, la biotecnología, la nanotecnología y la transformarán la medicina, la industria manufacturera, el transporte, y más. Los robots industriales están evolucionando de los requieren condiciones pre-programados a las máquinas que operan en entornos impredecibles. La convergencia de la inteligencia artificial, sensores y máquinas automatizadas se traduce en drones asequibles personales, la promesa de entrega de aviones no tripulados, y los automóviles de auto-conducción.
———————-
Autos robot de Google se han graduado en la conducción en carretera y calles de la ciudad. CEO de Tesla, Elon Musk dice que sus coches eléctricos serán automatizados el 90% de todas las millas conducidas por el próximo año y cree que van a ofrecer completo piloto automático a sólo cinco años a partir de ahora. A principios de este año, la firma de secuenciación genómica, Illumina, anunció que su más reciente secuenciador podría transcribir 18.000 genomas humanos al año en $ 1.000 cada uno. El costo, una vez en los cientos de millones por genoma, ha disminuido mucho más rápido que la Ley de Moore. Illumina piensa en 228.000 genomas se secuenciaron este año y la tasa anual se duplicará, alcanzando 1,6 millones en 2017.
Según Raymond McCauley, de la catedra de biotecnología y la bioinformática en la Universidad de la Singularidad, la secuenciación genómica puede costar unos pocos centavos en 2020. Vamos a ser capaces de diagnosticar la enfermedad mucho antes, haciendo los tratamientos más eficaces, y la transformación moderna medicina de reactivo a preventivo. Estos son sólo algunos ejemplos de los temas tratados en la Cumbre Europa-participantes también aprenderán acerca de exoesqueletos robóticos; la medicina regenerativa con células madre e impreso 3D tejidos y órganos; lab-on-a-chip de diagnóstico; corte de la inteligencia artificial y aprendizaje automático borde; y la poderosa convergencia de estas tecnologías.
———————–
El evento tiene como objetivo atraer a 900 ejecutivos y empresarios que abarcan industrias, experiencia y conocimientos. Esta mezcla de diversos orígenes ha sido conocido por producir grandes nuevas ideas y emprendimientos. Los participantes también escucharán lanzamientos de inicio, las nuevas tecnologías de la experiencia práctica, y conectarse con otros individuos talentosos y emprendedores. Se llevará a cabo en el Teatro DeLaMar, en el corazón de Amsterdam, una de las capitales de inicio más calientes de Europa. El DeLaMar es uno de los lugares más nuevos y modernos de eventos en los Países Bajos. Sus espacios abiertos ofrecen un buen flujo y conexión junto con varios bares y zonas para demostraciones y sesiones de trabajo. El ritmo del progreso se está acelerando. Como dice Peter Diamandis, “La única constante es el cambio”.

———————–

See on Scoop.itNovedades Cientificas y Médicas

Sin protección contra Asteroides

3 julio, 2014

Forget Armageddon, says Ed Lu. Forget sci-fi space shuttles. Forget burying nuclear bombs in comets. Forget all that. Asteroids are a real and

Source: singularityhub.com

¿NO QUEREMOS SER COMO LOS DINOSAURIOS?

—————–

Nosotros no queremos ser los dinosaurios, pero la Tierra tiene más cráteres que la Luna, aunque sus huellas estan ocultas por el agua y la vida vegetal o se han diluído por los procesos geológicos. Los impactos son comunes. El evento de Tunguska en Rusia en 1908 donde un asteroide aplanó 1.000 kilómetros cuadrados de bosque en Siberia, o en el 2013 cuando un asteroide más pequeño detonó con una fuerza equivalente a unos 440 kilotones de TNT sobre la ciudad de Chelyabinsk, Rusia rompiendo ventanas. Tunguska fue una explosión de varios megatones, más grande que las más poderosas bombas atómicas en existencia.
——————-
El 99% del problema es encontrar los asteroides primero. La Fundación B612 es la construcción de la primera con fondos privados. El telescopio espacial profundo, Llamado Sentinel, busca encontrar y mapear el millón de trozos cercanos a la Tierra de rocas espaciales, de las que no sabemos nada. Los científicos han catalogado alrededor de 10.000 o el 1% de todos los asteroides cercanos a la Tierra. Se estima que hemos mapeado alrededor del 90% de las mayores amenazas a nivel de extinción. Pero el 10% se echa en falta en la acción, y no sabemos nada de los millones o menos asteroides más pequeños, pero todavía inmensamente destructivos que podrían destruir un área de un estado o ciudad.
—————–
Parte del problema es que los telescopios en la Tierra o en la órbita de la Tierra tienen una visión limitada. Y los asteroides son del color del carbón. La proverbial aguja en un pajar. Hay una solución relativamente sencilla, sin embargo. Es poner un telescopio cerca de la órbita de Venus para ampliar nuestro punto de vista, darle la espalda al resplandor del sol, y buscar en infrarrojo, donde el calor del asteroide oscuro, sea más fácil de detectar. Esta es la estrategia del B612, con un telescopio de $ 450 millones llamado Sentinel. El proyecto está en marcha. Ball Aerospace, la empresa detrás del telescopio espacial Kepler y la óptica del telescopio espacial James Webb (entre otros proyectos, incluyendo el Hubble), construirá Sentinel, el que se lanzará en un cohete SpaceX Falcon 9 en el año 2018. El telescopio asumira una órbita de Venus mirando hacia atrás a la órbita de la Tierra, y los datos serán enviados a la Tierra, donde calcularemos las órbitas de asteroides.
——————
De acuerdo con B612, Sentinel podrá encontrar más de 20.000 nuevos asteroides en su primer mes, más que todos los que se encontraron en los 30 años que hemos estado buscando. Durante su misión de 6,5 años (y que podría ser más tiempo), el equipo cree que va a descubrir y catalogar el 90% de todos los asteroides más grandes de 140 metros y muchos asteroides más pequeños de hasta 30 metros. Todo esto es Técnicamente posible, pero ¿por qué no tenemos ya un telescopio ahí arriba?. Por un lado, HAY POCA VOLUNTAD POLÍTICA para financiar el proyecto. Quizás se deba a que hay una percepción del riesgo demasiado baja. Quizás no somos tan inteligentes como creemos aún. ¿cuáles son las probabilidades de que impacte y golpee una ciudad?. La urbanización se concentra en una fracción relativamente pequeña de la superficie de la tierra, y por ello la probabilidad de un ataque directo parece remota.
——————
Ni siquiera el saber que podemos evitar ciertas causas de muerte por enfermedades que podrían ser curables parecen moverno un pelo. Los dineros de la sociedad, los cuales incluyen también los ingresos publicos de los estados, estan dirigidos hacia otras cuestiones: subsidios, guerras, corrupción, etc. y la opinión publica no parece estar interesada ni siquiera en como se usan estos dinero. La gente solo trabaja y paga impuestos casi ignorando lo que sucede. Incluso, hay una gran parte que cree no pagar impuestos porque no tiene obligación de presentar declaraciones juradas, pero es claro que todos pagamos impuestos, lo sepamos o no.

—————–

Los países que avanzan

1 abril, 2014

See on Scoop.itAprender a votar = pensar en los otros – La Historia que debe conocer – Los Sistemas Politicos –

Refernan Ref‘s insight:

RANKING DE PAISES SEGUN SU PODER DE INVENCIÓN

El informe anual de la OMPI (Organización mundial de patentes intelectuales), una organización integrada por 187 países, revela que EE.UU. sigue siendo el líder mundial en innovación, con 57.300 solicitudes de patentes internacionales presentadas en 2013, le sigue JAPON con 44.000 solicitudes de patentes, CHINA con 22.000 solicitudes, ALEMANIA y COREA DEL SUR con 12.400 son las que siguen.

 

Latinoamerica solicitó en total unas 1000 patentes internacionales el año pasado, una cifra mínima si se la compara con las 12.400 de Corea del Sur o las 1600 de Israel. En otras palabras, los 32 países de América latina juntos -con casi 600.000 millones de personas- presentaron menos del 10% de las solicitudes de patentes internacionales presentadas por un solo país como Corea del Sur, un país de solo 50 millones de habitantes.

 

Brasil presentó 660, México 233, Chile 144, Colombia 82, Argentina 26, Perú 13, Costa Rica 12, Cuba 9 y Venezuela 1. Es claro que los sistemas politicos y económicos latinos no dejan que la innovación prospere. Eso precisa tener un buen sistema educativo, incentivos fiscales para estimular la investigación y desarrollar nuevos productos, que exista el crédito y políticas que favorezcan la movilidad de personas altamente calificadas, para traer talentos de otros lugares. Como sabemos, latinoamerica esta dominada por una ideología politica populista que se expandió desde Cuba y Venezuela hace décadas.

¿Hay una relación directa entre la inversión de los países en investigación y la cantidad de patentes que producen?. Fink dice que sí: “China gasta el 1,7% de su PBI en investigación y desarrollo, mientras que casi todos los países latinoamericanos gastan menos del 1%”, explicó.

Respecto de si América latina no debería gastar más en escuelas, hospitales y comida para los pobres en lugar de estimular la innovación tecnológica, Fink dijo que esos argumentos pueden ser válidos para los países más pobres del mundo, pero no para países latinoamericanos de ingreso medio.

 

Hace apenas 50 años, Corea del Sur y otros países asiáticos que hoy sobresalen en innovación eran tanto o más pobres que los países latinoamericanos. Pero mientras los países asiáticos invirtieron en educación de calidad, investigación y desarrollo, y gran parte de América latina despilfarró su dinero en subsidios sociales provisorios que crearon una falsa sensación de progreso, sin generar crecimiento a largo plazo.

 

Los nuevos datos de la OMPI ayudan a explicar por qué los países asiáticos han crecido tanto y reducido la pobreza más rápidamente que los latinoamericanos. Habría que seguir su ejemplo y apostar a la educación de calidad, la ciencia y la tecnología.

See on www.lanacion.com.ar

50% de gente cree en teorías de conspiración médica

21 marzo, 2014

See on Scoop.itNovedades Cientificas y Médicas

AQUI SI QUE LAS TEORÍAS CONSPIRATIVAS MATAN GENTE!

Al igual que ocurre en la politica y economia, las teorias conspirativas terminan confundiendo al lector desinformado o descuidado. La gran diferencia es que en temas medicos, esto puede llevar a su muerte.

Una Encuesta de la Universidad de Chicago, en estados unidos, ha demostrado Que las teorías de la conspiración Relacionadas Con El Ámbito Médico pueden Tener Más aceptación de lo q

Refernan Ref‘s insight:

50 % DE LA GENTE CREE EN CONSPIRACIONES MEDICAS (?)

La ignorancia esta mucho más presente en todas las áreas de la vida y en la sociedad, de que lo pensamos. Encuesta de la Universidad de Chicago, en Estados Unidos, muestra que las teorías de la conspiración relacionadas con la medicina pueden tener más aceptación de lo que se piensa, ya que casi la mitad (49%) de los ciudadanos podría llegar a creerse alguna. Así surge de los resultados de encuesta publicada en revista JAMA Internal Medicine, con 1.351 adultos.

En concreto, se les pidió opinión sobre 6 informaciones conspirativas que son famosas y andan por ahí haciendo estragos, veamos cuales son:

a) las autoridades sanitarias impiden el acceso a remedios naturales contra diversas enfermedades
b) que una agencia de espionaje de EE.UU. contagió con VIH a muchos afroamericanos
c) que el Gobierno sabe que hay una relación entre el uso de teléfonos móviles
d) el Gobierno es cómplice de que las vacunas infantiles pueden provocar autismo
e) que se está usando organismos genéticamente modificados para reducir la población mundial
f) que la fluoración del agua favorece que las empresas viertan sus sustancias químicas peligrosas para el medio ambiente.

Normalmente estas teorías son más fáciles de entender que una información científica compleja, según ha reconocido Eric Oliver, autor del estudio, que también apunta que las personas que creen en estas ideas conspirativas pueden presentar diferencias a la hora de cuidarse su salud. Por ejemplo, han apuntado, mientras que el 13% de las personas que rechazaban estas creencias, usan suplementos naturales, el porcentaje subía hasta el 35% entre quienes se creían tres o más teorías conspirativas, que usaban el triple de estos productos a la semana.

Las personas que creen en conspiraciones suelen ser propensas a optar por la medicina alternativa en lugar de la tradicional, una relación que debe ser percibida por los médicos a la hora de hacer un seguimiento de la medicación prescrita. Es importante aumentar la información sobre la salud y la ciencia, sobre todo porque las personas con menos niveles educativos son más fáciles de convencer para que rehuyan de un pensamiento más científico.

See on www.elmundo.es

La ciencia de Fringe scifi TV

2 marzo, 2014

higieneSee on Scoop.itNovedades Cientificas y Médicas

scifi y la ciencia

Refernan Ref‘s insight:

FRINGE LA SERIE DE TV (SCIFI)

EL FÍSICO Michio Kaku nos explica si la ciencia de la serie de TV es posible. A continuación veamos punto por punto lo que plantea.

¿EXISTE UN UNIVERSO ALTERNATIVO?.

Muchos fisicos cuánticos hoy incluyendo varios de mis amigos y colegas que han ganado premios Nobel, se inclinan hacia la existencia de mundos alternativos. Afirman que el Universo cuántico está dividiendose contínuamente en Universos Paralelos. La Teoría de cuerdas (mi especialidad) también nos lleva naturalmente hacia esa interpretación: la Existencia de “multiversos”. Esto significa que puede haber varias copias de nosotros mismos en universos diferentes. Y cada una de esas copias insisten en que son la real y el resto son copias Falsas.

Pero esto no quiere decir que podemos entrar facilmente a esos Universos Paralelos, como aparece en la serie de tv. Piense que usted cuando escucha la radio en su sala de estar, si bien hay muchas otras ondas en la habitaciones, usted solo esta conectado con una. Del mismo modo, ocurre en los universos cuanticos, usted solo conecta con uno. Es sorprendente que pueda haber muchos universos en su sala, pero usted no puede hacer contacto entre ellos. Visto asi, Elvis podría estar vivo en alguno de esos universos.

de el Muchos Temas Sí exploran en Fringe, incluyendo Viajes en El Tiempo, el Cambio de forma y la Distribución de un sueño. ¿Cual de ESTOS tres Temas Hijo del los teoricamente Posible Mas?

De todas las tecnologías que plantea la serie, la más cercana a conseguir creo que es la del INTERCAMBIO DE SUEÑOS. Ya en la Universidad de California, en Berkeley, los Científicos han colocado Sujetos en una escaner MRI, y con un ordenador que decodifica las señales mentales que emanan del cerebro, pueden montar una imagen razonable de lo que la persona piensa. Aunque aún esta en sus inicios. En Kyoto, los cientificos han sido capaces de  leer en el cerebro de las personas. Un Posible paso siguiente es colocar a una persona durmiendo en la máquina de resonancia magnética, y decodificar sus imagenes al soñar, y luego ponerlas en una pantalla. Esto ya es un hecho. Hasta el momento las imagenes son demasiado crudas, pero con el tiempo, esto mejorará. Por Ello , puede ser posible que logremos ver nuestros sueños y grabarlos en un DVD que al despertar miramos. Además, alterar deliberadamente los sueños a medida que ocurren también parece que es posible. El sueño lucido del cual muchos hablan lo prueba y ya fue verificado en el Instituto Max Planck en Alemania.

Otra tecnología posible es el CAMBIAR DE FORMA de las cosas. Ya podemos crear chip como granos de arena que reaccionan alternado la carga electrica, por lo tanto, los podemos programar a responder ordenes. Esto se llama MATERIA PROGRAMABLE. La clave podría ser crear nanobots del tamaño de moleculas y alterar absolutamente la materia, de esta forma. Asi el replicador de STAR TREK no esta lejos de nosotros. Si bien debemos saber que la técnica para lograrlo esta aún a siglos de nosotros, si tomamos en cuenta a la velocidad que avanzamos en tecnología.

También es teoricamente Posible, aunque Difícil, VIAJAR EN EL TIEMPO. Si usted tiene suficiente energía, digamos la de un agujero negro, como para crear un agujero en el espacio, y luego tiene suficiente energía negativa para evitar que se cierre por la fuerza de gravedad, se puede hacer. Claro que esa tecnología esta a miles de años de nosotros. Pero hasta ahora, no se ha podido encontrar un error en las ecuaciones que indican que esto es posible.

Una OBJECION podria Servicio de Mí Radiación Sí acumula al Pará Para entrar en La Máquina del Tiempo, ya mí de Energía Pueda circular onu del numero infinito de Veces en La Máquina del Tiempo . Entonces podria Explotar pronto tan entrás COMO. A ESTE PROBLEMA Pero Puede Ser Eliminado En La Interpretación ManyWorlds, Donde la Energía Hace apenas Una Sola Vez en el Dispositivo. Para resolver la Cuestión, Una NECESITAMOS “Teoría del todo”, al Igual Que la Teoría de cuerdas, Parrafo el Cálculo de la Radiación Que pueden servi CREADOS Por La Maquina del Tiempo.

Los Experimentos en la serie de TV, donde Entrar usando Una droga “Cortexiphan” con la Agente Dunham, era niña ella CUANDO, POR Walter Bishop y William Bell y el Resultado Dejo un con Olivia y Los Otros Niños aumentadas Las HABILIDADES MENTALES. Claro Que el Cortexiphan No Es, reales servi Pero SI ES DECIR Seguro de Que Las HABILIDADES MENTALES pueden aumentadas. Varias Hay Formas en Que se podria, en Principio, mejorar nuestra Palabra palabra capacidad cerebral. En Lugar de imprimación, MEDIANTE EL USO de la genética. Ya, los Científicos de Princeton Han Descubierto el gen “inteligente Ratón”, y Con El, ESTOS TIENEN Ratones Más memoria: navegan laberintos Más Rápido, aprenden Mas. Las Vías Químicas Que Hacen Posible TODO ESTO también hay decodificados SIENDO ESTA.

Los Seres Humanos Tienen Una contraparte de Este gen es del nuestro de Cuerpo, Porción Lo Que Posible podria Servicio Un día mejorar Nuestras HABILIDADES de esta Manera. Ademas, somos el 98,5% Genéticamente Equivalente ONU chimpancé un, del nuestro de vecino Más Cercano, Pero vivimos el doble de Tiempo y somos Mucho Más inteligente. Por Ello, baño ESE Monton De genes Que nos diferencian estan Los Que duplican la DURACIÓN de Nuestra Vida y también nuestra Inteligencia. genes Estós Y ESTAMOS encontrando Ahora.

También los Científicos de han del ESTUDIADO Una los Individuos con “SINDROME SAVANT”, en el Que se sufren trastornos mentales, Pero Tienen Fantásticas HABILIDADES de Cálculo y Artísticas, Más Allá de lo normal, tal COMO SE VE en Ray Hombre. Por lo general, heno Una CIERTA degeneración, DAÑO O Lesión En Una Parte Específica de hacer lóbulo temporal Izquierdo de hacer cerebro. Se cree, Aunque No probado no no está, ESTO rompe Que el Equilibrio Entre el cerebro Izquierdo y Derecho, Porción Lo Que el sentido hemisferio direction derecho del cerebro-Compensa el Deterioro del lóbulo temporal Izquierdo, Haciendo Que ESTAS HABILIDADES Surgan ONU LA SUPERFICIE (las Que normalmente suprimen Sí).

Algunos Científicos de han del Tratado de USAR Dispositivos Magnéticos craneales parrafo “cerrar” this zona del lóbulo temporal Izquierdo e inducir esa capacidad. Los RESULTADOS DE ESTE EXPERIMENTO fuerón mixtos, CON ALGUNAS Mejoras Que Tienen Lugar, nada de Pero de Como lo Que se ha encontrado con baño individuos Estós. Posible Servicio Florerias, embargo de Pecado, De que Algún Día La milagrosas Ciència PUEDE Duplicar ESTAS Capacidades. Hasta Ahora, no EXISTE en Una forma comprobada de aumentar ¿¿Nuestra Palabra palabra capacidad cerebral. Todo ESTO sugiere Que pronto podria Estar bien Dentro de las Leyes de la Ciencia, el mejorar nuestra Inteligencia.

¿niños no quieren ser Científicos?

19 febrero, 2014

See on Scoop.itNovedades Cientificas y Médicas

Siguenos en facebook: https://www.facebook.com/AteismoBrillante Y siguenos claro en el Blog: http://ateismobrillante.blogspot.com/

Refernan Ref‘s insight:

La opinión de un cientifico sobre este tema. Nuestra sociedad no premia a quienes realmente nos ayudan a mejorar nuestras vidas, sino más bien a quienes tienen publicidad en los medios (jugadores, deportistas, artistas, rockeros, etc.)…es lamentable porque el mundo para avanzar precisa más gente pensante y menos gente con pocas ideas…

See on www.youtube.com

La importancia del conocimiento

9 junio, 2013

El ser humano tiene una parte creativa y otra parte destructiva, y la tecnología está multiplicando ambas partes, de ahí el temor de algunos frentes a los avances de la ciencia y la tecnología, falacia que desaparece si se analiza el tema a través del tiempo. Veamos un repaso de los grandes avances del ser humano:

En 1947: pasamos del tubo de vacio al tránsistor de silicio –

en 1959: al circuito integrado (chip) – en 1970: se agregó el microprocesador –

en 1973: xerox puso el ratón – en 1975 apareció el apple y en 1981 IBM la PC – aparece Microsoft y luego windows –

y en 1990: se masifica internet y la web —> y ahora vamos por el ordenador molecular.

En 1999 la supercomputadora Deep Blue de IBM vence al campeón mundial de ajedrez Gary Kasparov y en el 2001 en el programa de TV Jeopardy (concurso de conocimientos generales) triunfo una computadora llamada Watson de IBM, marcando un antes y un después en el campo de la inteligencia artificial (IA).

————————————————————-

El último logro más notable del hombre se logró en el 2000, con un costo de U$ 3.000 millones y con el 90 % financiado por EUA e Inglaterra y al lograr terminarlo, se le llamó proyecto genoma humano, este fue luego donado por estos paises y proclamado patrimonio de la humanidad y puesto al alcance de todo el mundo ! (la A con la T y la C con la G). Estas 4 moleculas bases constituyen los genes y se duplican usando una proteina llamada polimerasa. Sucede una mutación de cada 10.000 millones de pares de bases aparejados al duplicarse. La célula al envejecer se autoelimina, pero si sufrió un mala mutación, sigue reproduciendose, originando un cáncer. La falta de autoestima o el estrés, genera más cortisol y baja la cantidad de leucocitos y asi, bajan las defensas del sistema inmune. Para que el cáncer sea maligno debe haber 2 tipos de genes andando mal: el gen hongo que causa el crecimiento desmesurado de la célula y el otro es el gen supresor, que no actúa. Si actúara el supresor sería un tumor benigno.

Luego en el 2003 apareció una nueva complicación: el epigenoma y su lectura, en el cual aún estamos inmersos: con ella ahora sabemos que la Dieta y actividad enzimatica influyen sobre los genes. Como el cuerpo humano se renueva totalmente, por división celular, cada 7 años y el material que se precisa para ello proviene de la comida, entonces la dieta puede prevenir, geneticamente, lo peor. Activamos y desactivamos genes con nuestra dieta (Dieta ==>>proteínas ==>>enzimas ===>>genes). El sol, el estrés, el té verde tienen también influencia epigenética y los alimentos con folatos (berenjenas, porotos), aceite de higado de bacalo, el salmón, activan genes que producen anticuerpos. El brocolí, la palta, la granada, son las estrellas epigenéticas. La lechuga, los cereales, verduras de hojas verdes (espinaca, rúcula) tienen ácido fólico, que tienen especial papel en la metilación de los genes. Aún hay células madres en el interior de los huesos largos de los adultos, en la médula ósea. Al hacer ejercicios, las células madres de grasa se convierten en musculo.

————————————————-

Hoy sabemos que solo unos pocos genes generan las diferentes razas humanas y fueron necesarias para poblar el mundo, se puede engendrar niños a partir del dna de dos mujeres o dos hombres y asi las parejas homosexuales pueden tener hijos naturales, es decir, con la información genética de ambos. También se pueden modificar las caracteristicas de la persona introduciendo genes con caracteristicas adicionales, como la inmunidad a cierta enfermedad o la  capacidad de tocar guitarra y así a evolucionar a una nueva especie humana. Nuestro genoma tiene genes de otros hominidos: sabemos que los nerdeanthales se asentaron en europa unos 300.000 años antes de que los sapien salieran de africa y los hallaran hace unos 35.000 años. Luego se extinguieron.

——————————————-

Mientras todo esto sucede, el futuro relacionado con las ciudades esta apuntando a la arquitectura sustentable o sostenible, término que también se aplica a la economía. De la soldadura de fragua que unía los metales x calor, pasamos a la soldadura de arco electrico, que llega a 4.000 ºC y el acero se funde a los 1.600 ºC. Y en 1928 esta terminó reemplazando los remaches con ella en la construcción para unir acero, la que brindó más espacio y mayor resistencia. Hoy se reemplazó el electrodo por un alambre y un carrete que suple directamente la pistola de soldadura. La soldadura más fuerte actual es por explosión y logra unir unos 162 metales diferentes (une aluminio, acero al carbono, acero inoxidable, etc.) y origina metal clad, común en las plantas petroleras. Por su parte el gas y el petroleo precisó de soldaduras marinas  para su ampliación, que funciona con corriente continua, y con los autos y otras cosas, se usan soldaduras de punto con electrodos de cobre, para unir metales delgados, unas 5.000 por cada auto, usando robots. Para soldar plastico y otros objetos se usa soldadura por fricción, generando calor, y en 1964 se patentó la soldadura en plastico ultrasonica, para pomos plasticos, dentífrico, juguetes y sellos hermeticos de envases. El avance en las soldaduras más la aparición del cemento en 1850, el convertidor de acero de 1856, había multiplicado x 10 la resistencia de la piedra y del ascensor en 1853, el cielo paso a ser el límite en la construcción.

————————————————-

El 1º rascacielos se hizo en Chicago, 30 años despues de aparecer el cemento. En el 2008 se estudio la posibilidad de hacer rascacielos que ocupan media hectarea, auto-sostenibles en producción de alimento y energía, y pueden vivir unas 50.000 personas, llamados granjas verticales. En Abu Dabi esta el futuro de los emiratos arabes unidos, donde se hizo el proyecto Masdar, que es la 1º ciudad sin coches, sin basura y sin emisiones de carbono, para unas 50.000 personas. En los 6 Km2 que ocupa se invierten 17.500 mill de euros. Usará energía solar y eolica y los edificios no tendrán mas de 5 pisos. Su temperatura media será 20ºC inferior a su entorno. Sus aguas residuales y desechos se reciclaran. Se proyecta terminaría en el 2025. Un proyecto llamado vivace (Univ. de Michigan), consiste en acelerar el oleaje maritimo usando unos cilindros que suben y bajan, que no afecta la vida ni el medio ambiente y de esta manera sirve para crear ese oleaje útil para producir energía calculada para el doble de los habitantes actuales del planeta. Los arboles son más ecológicos que el cesped: la ciudad de los jardines y los chalets es la menos ecológica de todas (consumen más energía, mas suelo, más agua) pues es una ciudad dispersa. Por su parte, el edificio El Taipei 101 en Taiwan de 509 mts, tiene conexión a internet vía satelite y sus ascensores son los más rápidos del mundo (hacen 89 pisos en 40 segundos a más de 60 km/h) dotados de cierre hermetico para evitar dolor de oídos. Se estudian viviendas autosuficientes con techo con placas fotovoltaicas que generan energía electrica p/calentar agua de la ducha, lavadora y lavabos y almacen el agua de la lluvia en depósitos subterraneos que abastecen al termotanque, todo en un circuito cerrado. En las placas voltaícas que buscan crear electricidad con la luz, esta el proyecto de los puntos cuanticos podrían subir esto al 86% en el futuro.

————————————————————–

El 1º motor de combustión interna fue diseñado en 1860 y fue usado para bombear el agua de las minas de carbón inundadas y en 1878 se patentó el 1º motor de combustión interna de 4 tiempos (un pistón dentro de un cilindro, una biela y un cigueñal) que transforma el sube y baja del pistón en el mov. rotatorio de arbol de transmisión. En 1892 Diesel inventó su motor también, hoy usados en grandes camiones y maquinaria pesada. Luego en 1924, el alemán Bankel ideó el motor rotativo, que gracias al movimiento giratorio del pistón, en vez del sube y baja, reduce drasticamene la vibración. El mazda XR8 con motor rotativo (sin valvulas ni arbol de levas ni pistones) en 2001, con 255 hp, es un buen ejemplo de su aplicación presente. Luego en 1941 aparece el motor a reacción, que es una turbina de gas, que proporciona el impulso. Alemania fabricó el 1º avión en serie con el, luego fue Inglaterra en 1943. El cohete usa el motor a reacción y toman el oxigeno de un tanque, mientras el avión lo toma del aire. Como dato curioso, sepamos que la ciudad de Los angeles en EUA tuvo su primer atasco automotor el 26 de julio de 1943.

———————————————–

Con la miniaturización, se sabe que disminuir el tamaño de un motor en 3 veces, disminuye la fuerza solo 2 veces, y asi es más eficiente. (1 nanometro = unos 10 átomos en fila). Por su parte, la energía hidraulica (fluidos a presión en un sistema cerrado), aumentó 10 veces la fuerza mecánica, y es la que da fuerza bruta a las máquinas pesadas, gatos hidraulicos, al camión con remolque hidraulico de volteo, a los juegos de disney, aviones, etc. En 1790 un ingles puso a prueba el principio de pascal en su prensa hidraulica. Pero cuando se empezó a usar, alrededor de 1800, se usaba agua y los sellos para evitar fugas, eran malos. El descubrimiento del petroleo en 1859, dió lugar a un mejor fluído o aceite hidraulico, el cual posibilito usar las prensas hidraulicas y luego, el freno hidraulico y la dirección hidraulica en los autos, antes de la 2º guerra mundial. El 1º fue actualizado con un reforzador x vacio que hace que se detenga más rápido un mayor peso con un solo toque del pedal y el 2º también cuenta con asistencia la que aumenta el fluído hidraulico de acuerdo a la veloc. con que se gira el volante. También se usa en la suspensión activa, un pistón hidraulico que sube y baja sobre el resorte de la suspensión, y asi sube y baja la rueda y en el control activo de la carrocería, en los autos de alta gama, que mantiene la estabilidad ante giros bruscos y carreteras irregulares. Si el auto cae en un pozo, activa equilibrar la carrocería. También sirve para cambiar la suspensión a conducción deportiva y la hidraúlica hace el resto.

En la construcción mueve excavadoras, grúas, camiones, trituradoras y perforadoras de túnel (estas llegan a usar 3.000 lts de fluído hidraulico en 11 km de mangueras) pues proporciona más fuerza y potencia que el motor electrico a menor precio: impulsa los pistones del taladro con una fuerza de 370 kg x cm2. La cabeza del taladro gira usando la energía de un motor electrico de 10.400 hp pero la energía hidraulica permite fragmentar rocas, unos 8 mt x hora. Las gruas que levantan contenedores de mas de 40.000 kg usan la energia hidraulica también. En el interior del fuselaje de un avión comercial hay un intrincado sistemas de bombas y mangueras con fluído hidraulico que activan los controles, timón de dirección, el tren de aterrizaje (desde 1929), torretas, alerones, frenos hidraulicos, etc. Las palancas y poleas fueron desapareciendo gradualmente de los aviones.

—————————————————-

Hay 3 tipos de bombas hidraulicas (transfieren liquidos de un pto a otro): para liquidos de baja viscosidad se usan las centrifugas, para líquidos viscosos las bombas rotativas y cuando hace falta mucha presión se usan las Bombas de piston. Tanto estas como los selladores y fluidos sintéticos resistentes y lubricantes fueron mejorando. El mayor avance de la hidraulica en aeronautica es el activador electrico hidrostatico de los 90´ tiene todos los elementos de un sistema hidraulico en un pequeño bloque y con el, se eliminan cientos de metros de tuberia hidraulica y ciento de kilos de peso, fue usado para hacer el AirBus A380, que tiene un fuselaje de 73 mts y más de 300 tn de peso. Ahora se esta estudiando usar motores electricos para eliminar los sistemas hidraulicos en los controles de vuelo, pero aún no es posible.

En las ciudades, las bombas centrifugas suben el agua desde el nivel del mar a unos 500 metros, para luego repartirla en las ciudades. Fueron los griegos, con Arquimedes quién inventó una bomba rotativa o de tornillo en el año 200 a.C. que usa un único tornillo helicoidal en el interior de una carcaza cilindrica: un extremo en el agua y el otro inclinado unos 4 metros, al girar el tornillo el agua va subiendo hasta la otra punta. Los romanos se apoderan de Grecia en el 30 a.C. y aprovecharon estos conocimientos y los mejoraron: de ahí sus acueductos. Hoy se siguen usando estas bombas de tornillo, ideales para elevar aguas residuales con restos unos 10 mts y luego las bombas centrifugas la bombean a las plantas de tratamientos de residuos. Para sacar agua de un pozo no sirve la bomba de tornillo que debe usarse inclinada. Por eso se hizo la bomba de pistón o émbolo también en esa época, que crea un vació en el interior de la bomba y hace subir el liquido: cuando alguién levanta el pistón accionando una manivela, se abría un válvula en la parte inferior de la bomba y la presión atmosferica conducía el agua a su interior, y cuando bajaba el pistón el agua subia pasando por otra valvula más arriba y cuando el pistón se levantaba de nuevo, hacía salir el agua de la bomba. El problema es que solo pueden elevar el agua 9,7 metros, pues por encima de esa altura la presión en el interior de la bomba es mayor que la presión atmosferica. En 1580 unos alemanes lo solucionaron, usando dos niveles de bombas.

Hoy las podemos ver bombas de plastico en envases de jabones liquidos, perfumes, un inflador de pie, etc. Cuando no hay desnivel, se usa la bomba centrifuga para llevar el agua, esta tiene un rueda rodete que hace girar el agua en el interior: entrando por un lado de ese rodete y sale por el otro, a mayor velocidad y asi suben en contra de la gravedad, pero usa un motor potente y constante para ello. Los motores diesel y electricos solucionaron esto y pueden bombear hasta un 40% de sólidos junto con agua, como lo hacen en las minas de fosfato, donde transporta ese lodo por kilometros. También se usan para repostar aviones en los aeropuertos y se controlan con ordenadores (donde trasladan 1.200 lts x minuto). Las gasolineras hacen igual, pero la bomba esta en el deposito subterraneo de la misma y esta envía el combustible hasta el tanque del auto. La boquilla que introducimos en el tanque es en realidad una válvula y al pasar el combustible por el surtidor se activan 2 pistones unidos a un cigueñal: uno cuando entra y otro al salir y cada pistón en cada ciclo, deja pasar una cantidad exacta de combustible. El cigueñal activa sensores que transmiten impulsos a un procesador, donde cada pulso es una cantidad determinada de combustible, que el procesador transforma en un número digital que se ve en la pantalla. Asi funciona desde 1933.

——————————————–

Estas bombas domesticas estan hoy en los rociadores de agua, perfumes, lavamanos, etc. todas son bombas de piston que desplazan aire o liquido. Con un buen motor, las bombas de pistón pueden lanzar agua por una boquilla a 2.400 km/h que agujerean un ladrillo y con un motor diesel de 600 hp para los pistones, y añadiendo un abrasivo ligero, se logra cortar el acero. Las bombas de pistón llamadas de varilla se usan para llevar el petróleo desde el subsuelo a la superficie desde 1920, y usan un motor electrico que hace giran un par de bielas que mueve un eje arriba y abajo y asi eleva en cada ciclo de 5 a 40 litros. La mantequilla de maní es 10 veces más viscosa que el petróleo no procesado, y con ellas se usan las bombas rotativas, llamadas bombas de engranajes internos: estos engranajes al girar, expulsan el liquido viscoso al exterior en un flujo continuo. Para ordeñar vacas se usan bombas rotativas que llevan la leche desde la vaca al camión y de este, al deposito de procesamiento: un brazo hidraulico cubre el pezón con una ventosa que reproduce la presión del ternero al mamar. En medicina también se usan bombas, y el corazón humano lo es. Al enfermar no bombea bien. El Jarvis 2000 es una bomba rotativa con carcasa de titanio ajustada en el interior del ventriculo izquierdo ayuda al corazón a latir y es ajustado x una bateria externa de 8 hs: en el 2006 se implantaron 200 y ha sido aprobado en europa para usarlo toda la vida. Los aviones mueven alerones, torretas, timones, tren de aterrizaje, etc. con energía hidraulica. El 70 % del agua potable esta en los casquetes polares. Para convertir el agua del mar en agua potable se usa un proceso llamado osmosis inversa (OI) que usa bombas potentes y filtros potentes para llevar el agua marina a traves del filtro formado por membranas dentro de un tubo, que no dejan pasar la sal.

——————————————–

La sonda espacial Cassini en 1997 fue enviada a Saturno usando energía atómica, generada por un generador termoeléctrico de radioisotopos que produce energía por décadas en forma estable. La nave llevaba 3 unidades de generación termoeletrica de radioisotopos: los isotopos se desintegran y producen calor, es decir, la materia se convierte en energia según la ecuación de Einstein sobre energía = masa x la velocidad de la luz al cuadrado (E=mc2) y los generadores convierten ese calor en electricidad. También en medicina se usan los isotopos radioactivos que atacan las células tumorales, y los alimentos e instrumentos médicos pueden ser esterilizados usando la emisión de rayos gamma (una radiación radioactiva) que impide la duplicación del adn de cualquier bacteria u otro organismo o los mata instantaneamente. También usamos tecnología nuclear con los detectores de gases radeon en casas y detectores de humo, con los relojes atomicos, cuya precisión es de 1 seg. c/8.000 años, algo útil para hacer más exactos a los GPS, y las imagenes por resonancia magnetica de medicina, que no es radioactiva, pero si los escaneres TEP que usa materiales radioactivos (Topografía de Emisión de Positrones).

En 1955 se hizó el 1º reactor nuclear que daba electricidad (hoy genera el 20 % en EUA): este es una versión sofisticada de una máquina de vapor (usa la energía térmica de la fisión nuclear para calentar agua y generar vapor), el cual acciona una turbinas que generan electricidad. La energía atómica x fusión (sin desechos) es el sueño que viene, usando 2 átomos de isotopos de hidrogeno (deuterio y tritio) se fusionan emitiendo energía, donde 1 gr de hidrogeno libera la misma energía que 8 tn de petroleo. Debería lograrse en el 2030. El hidrato de metáno es un forma de hielo que arde y abunda en el fondo de los mares, pero tiene el problema de liberar CO2, pero podría también ser una nueva forma de energía usable. En computación tenemos los cristales holograficos de datos, pueden almacenar información de 200 DVD por 1.000 años y se podrían leer los datos sin necesidad de un ordenador, aunque la mayoría precisa un láser. En nanotecnología, hacemos los nanotubos de carbono, que en teoría podrían ser usados para crear un ascensor espacial. Se estudia implantar microchips retinales para mejorar la visión y también la tele-retina. Esta la idea de producir hidrogeno como combustible usando agua a partir de energías renovables (solar, eólica o geotérmica).

——————————————–

En el 2004 se envia el spirit y el opportunity, y EUA anuncia el 14 de ene que esta en condiciones de llevar a Marte una nave tripulada. Es necesario que también los inventores tuvieron sus inventos fustrados o grandes fracasos, como son el coche volador, el auto a turbina, la casa de cemento de edison, o la casa circular de aluminio, suspendida en el aire por unos cables, de un mastil central y baño incluido. En medicina hay muchos inventos fallidos, con productos absurdos, como los supositorios con radium radioactivos, para mejorar la sexualidad, etc. Pero todos los intentos nos llevaron a hoy, donde tenemos acceso a todo el conocimiento humano al pulsar una tecla en nuestra computadora. Un niño en África con un teléfono inteligente accede a más conocimiento que el presidente de EE.UU. o Ruso de hace unas décadas atras. Gutenberg creo la imprenta en 1440 y tomó 400 años para que los beneficios de esta llegara a toda la gente. El teléfono llegó a un cuarto de la población en EE.UU., Europa y Rusia, en unos 50 años. Los celulares lo hicieron en unos 7 años y las redes sociales, wikis, blogs, en unos 5 años: el ritmo del cambio es cada vez más rápido. Las tecnologías avanzan linealmente (es decir, 1,2,3,4, etc.) hasta que se convierten en tecnologías de la información, donde avanzan exponencialmente (1.2.4.16, etc.). Esta sucediendo con la salud y la medicina.

Nuestro cuerpo tiene un software escrito en sus genes, sin actualizar desde hace miles de años, cuando escaseaba la comida y almacenar calorías era buena idea. Hoy quisiera decirle a mi gen receptor de la insulina grasa que no lo preciso más, asi comería menos, alejaría la diabetes, enfermedades del corazón y vivíría un 20% más. Estamos reprogramando la biología. Hoy con una impresora tridimensional se puede imprimir el 70% de las piezas que se necesitan para construir otra impresora tridimensional, y en 10 años llegaremos al 100 %.

10 Hechos relevantes del siglo XXI

16 marzo, 2013

A pesar de que apenas transcurrieron 13 años del nuevo siglo, la ciencia ya cuenta con hallazgos relevantes que podrían marcar el curso del siglo XXI. Con ellos se podría hacer una lista bastante larga. Una posible enumeración podría ser la que aquí proponemos.

1) Hallazgo del bosón de Higgs: La existencia de la “partícula de Dios, confirmada el miércoles pasado por la Organización Europea para la Investigación Nuclear (CERN) es uno de los hechos científicos con más repercusiones. Después de mucho tiempo rastreándola, finalmente fue cercada en el Colisionador de hadrones o “máquina de Dios”. De su existencia depende, entre otras cosas, que la teoría actual que explica el Universo visible (el llamado Modelo Estándar) sea correcta. Y no sólo eso: de sus características pueden depender las futuras investigaciones para comprender el Universo oscuro, que no está explicado por el Modelo Estándar.

2) Secuenciación del ADN humano: En 2003, un consorcio internacional formado por científicos de seis países descifró, dos años antes de lo previsto, la secuencia completa (99,99%) del llamado libro de la vida: el genoma humano. Aunque todavía no se han logrado predecir, diagnosticar y tratar muchas enfermedades, la medicina se ha transformado como nunca gracias a este hallazgo.

3) Reprogramación celular: reprogramar las células madre. Esta técnica desarrollada en 2006 en ratones, posibilita, entre otras cosas, que una célula de la piel o de un cabello se convierta en una neurona o en cualquier otro tipo celular de los 220 que componen nuestro organismo. Eso significa que gracias a ella se puede borrar la memoria del desarrollo de una célula, convirtiéndola en otra totalmente diferente después de haberla devuelto a su estado embrionario. El padre de esta técnica, el japonés Shinya Yamanaka, recibió en 2012, juntamente con el científico británico John B. Gurdon, el Nobel de Medicina.

4) Reinvindicación del ADN basura: La epigenética. No hay desechos en el genoma, gracias a las investigaciones del proyecto ENCODE (la investigación de mayor envergadura en el campo de la genómica), en 2012 se descubrió que el llamado ADN basura es mucho más útil de lo que se pensaba. En realidad, es esencial para que los genes humanos funcionen ya que regula su actividad.

5) Identificación de “Ardi”: como nuestro antepasado más antiguo. Es hembra, pesa alrededor de 50 kilogramos y mide unos 120 centímetros de altura. Fue hallado en Etiopía en 1992, y presentado en sociedad 17 años después. El 1° de octubre de 2009, en una edición especial de la revista Science, un equipo internacional de científicos describía por primera vez al aArdipithecus ramidus , una especie de homínido que vivió hace 4,4 millones de años en lo que hoy es Etiopía. Ardi destronó a Lucy, esqueleto parcial femenino deAustralopithecus afarensis , hallado en 1974, que vivió hace 3,2 millones de años y que era el resto más antiguo descubierto hasta la fecha y probó que los primeros antepasados humanos no se parecían en nada a un chimpancé o a otros primates de gran tamaño, como se creía por lo general.

6) El 19 de junio de 2008, la NASA confirmaba un secreto a voces: el planeta Marte albergaba agua. Hacía muchos años que los científicos estaban convencidos de ello, y es que así lo determinaban multitud de estudios previos, pero faltaba la prueba física. Y esta llegó gracias a la sonda Phoenix, la semana pasada. Marte volvió al primer plano otra vez cuando la NASA señaló que el planeta, alguna vez, tuvo formas de vida. Esa afirmación se hizo tras el análisis del robot Curiosity sobre la muestra de una roca marciana.

7) Observación de planetas similares a la Tierra: El 6 de marzo de 2009 fue lanzada la sonda espacial keppler, cuyo principal objetivo es hallar planetas extrasolares, especialmente aquellos que más se asemejen a la Tierra y que se encuentren en zonas habitables (con temperaturas ni muy frías ni muy calientes y con agua en su superficie). Kepler observa simultáneamente unas 150.000 estrellas y analiza su brillo cada 30 minutos para detectar posibles tránsitos de planetas. Recientes estudios concluyeron que en la Vía Láctea existen unos 17.000 millones de planetas parecidos a la Tierra. Eso quiere decir que una de cada seis estrellas del tamaño de nuestro Sol tiene un planeta similar al nuestro oribtando en torno de ella. Ya sabemos adonde ir, si logramos dominar la tecnología de viajes espaciales,, para poder salvarnos de la próximas extinciones.

8) Descubrimiento del grafeno: El material más delgado del mundo, transparente, flexible, resistente, conductor de electricidad, estas son algunas de la virtudes del grafeno. Fue descubierto casi de rebote (como otros muchos hallazgos de la ciencia) en 2004. Estudiando las capas de grafito que normalmente se desechan, el físico Andre Geim, de la Universidad de Manchester (uno más de estos odiosos anglosajones que viven inventando cosas para beneficiar a la humanidad), y el entonces estudiante de doctorado Konstantin Novoselov, hallaron monocapas cristalinas de grafito (grafeno) cuyas virtudes marcaron una revolución en la física de los materiales. Seis años más tarde, los dos científicos recibieron el Premio Nobel de Física 2010 por demostrar el comportamiento de una sustancia de carbono de un solo átomo de grosor, con implicaciones en áreas que van desde la física cuántica hasta la electrónica de consumo. Un ejemplo de su uso posible fue usarlo en el revolucionario dispositivo electrónico flexible y ultrasensible a la luz desarrollado por investigadores del Institut de Ciències Fotòniques (ICFO) que permitirá crear móviles flexibles y ordenadores que se podrán enrollar como una revista, o cámaras dotadas de visión nocturna que podrán hacer buenas fotos y filmar buenos vídeos incluso sin luz.

9) Solución al enigma de Poincaré: Un problema matemático menos que en 7 años de arduo trabajo le llevó al ruso Grigori Perelman encontrar la solución, al llamado uno de los llamados siete problemas del milenio: la conjetura de Poincaré. Este problema, planteado en 1904 por el matemático Henri Poincaré, no obtuvo una resolución satisfactoria hasta 2002, casi 100 años después de que fuera formulado. El matemático francés propuso una conjetura y Perelman le dió categoría de teorema demostrándola.

10) El avance de la nanotecnología: Uno de los mayores logros científicos registrados en 2001 fue la fuerte irrupción de la nanotecnología (la “tecnología de los materiales y de las estructuras donde se mide en nanómetros), con aplicación a la física, la química y la biología. Es considerada como el motor de la próxima revolución industrial y tiene aplicaciones múltiples en el campo de la electrónica, la biología o la medicina. Sus posibilidades son infinitas. En medicina regenerativa, por ejemplo, la idea es conseguir algún día liberar células o pequeños tejidos en órganos enfermos para que éstos puedan ser reparados. En 2001, los científicos fueron capaces ya de desarrollar componentes de computación de tamaño molecular, de millonésimas de milímetro. Este hecho conllevó a que la revista Science calificara dicha realidad como uno de los mayores logros del año. Se consiguió, entre otros éxitos, llevar a cabo intercambio de información a través de nanoalambres (un nanómetro es una millonésima parte de un milímetro).

Es claro que el mundo futuro será increíble: desde las fabricas caseras que nos darán todo lo que necesitemos, asi como la posibilidad de la vida eterna. Estas cosas eran impensables o inimaginables de concebir, hace tán solo algunos años. Pero es el futuro y es lo que vendrá.

A %d blogueros les gusta esto: