Posts Tagged ‘antienvejecimiento’

Terapia Génica antienvejecimiento

21 octubre, 2015

USANDO TERAPIA GÉNICA CONTRA EL ENVEJECIMIENTO
——————————————————————————-
En mamíferos, reducir la miostatina o aumentar la folistatina (que inhibe la producción de miostatina) se puede hace de varias formas, entre ellas con la terapia génica para la interferencia de ARN. Esto lleva a un aumento del crecimiento muscular, menor cantidad de grasa corporal y en ratones, al menos, una posible pero modesta extensión de la vida. La forma más directa es apagar el gen de la miostatina y es el camino elegido por investigadores chinos en trabajos con perros, usando CRISPR-Cas9, que es una forma de edición genética que es particularmente barata y precisa.
———-
Hay por lo menos una raza de perros en el que se ha producido una mutación natural del gene de la miostatina, e igual pasó con vacas, ratones (se llamaron ratones schwarzenegger), cerdos e incluso humanos, actualmente vivos y musculosos, como sus compañeros animales. La idea detrás es que la producción muscular mejorada es una terapia viable para para evitar problemas musculares conocidos y la sarcopenia, que es la pérdida progresiva de masa muscular y fuerza que se produce con el envejecimiento. Liz Parrish uso la folistatina o FS344 para actuar sobre la miostatina, lo que aumenta la masa y la fuerza muscular. Esto ha sido probado en pacientes con distrofía muscular.
———-
Es interesante contar que la empresa Bioviva, cuyo CEO es una mujer de 45 años, Liz Parrish, quién el 15 de septiembre, públicamente reconoció haber realizado una terapia génica de follistatina sobre ella misma, junto con otra alteración para evitar el acortamiento de telómeros: actuando sobre el gen mTERT, el cual en ratones de 1 año les alargó la vida un 24 % y en ratones de 2 años fue del 13 %. Lo hizo para adelantar los ensayos clínicos con humanos y los tratamientos dirigidos a frenar o revertir los efectos del envejecimiento. Como actuar sobre los genes esta prohibido en EE.UU. por la FDA, ella viajó a Colombia para hacerlo.
———-

See on Scoop.itNovedades Cientificas y Médicas

Como usar los datos en medicina

6 septiembre, 2015

El Aprendizaje automático y la ciencia de Datos van a Hacer Más pára Mejorar la Salud de TODAS LAS CIENCIAS BIOLÓGICAS Combinadas.

Sourced through Scoop.it from: singularityhub.com

LA IMPORTANCIA DE USAR DATOS EN MEDICINA ¿Cuál es la gran idea?

—————————————————–
Su genoma consta de aproximadamente 3.2 mil millones de pares de bases (el ADN) que codifican literalmente tu yo, es decir, toda tu persona. Su código de genes determina las enfermedades que podría tener, si es bueno en matemáticas o con la música, como será su memoria y cuan buena es, cómo te ves fisicamente, como te sientes, cuánto tiempo es probable que vivas y muchos más datos. Esto significa que si podemos descifrar este código genómico podemos predecir su futuro biológico y trabajar para anticipar y mejorar su salud.
—————
Es un problema de datos – y si usted es un científico de datos o experto de aprendizaje de máquinas- esto será el problema más interesante e importante que podría tratar de solucionar. En términos más simples, secuenciar un genoma significa convertir el ADN en una serie de cuatro letras que se parece a esto:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Y ese genoma es un archivo de texto de unos 300 gigabytes.
————–
Al comparar su genoma secuenciado con millones de genomas de otras personas y el conjuntos de datos de los servicios de salud, podemos usar la máquina de aprendizaje y técnicas de minería de datos, para correlacionar ciertos rasgos (color de los ojos, lo que su cara parece) o enfermedades (Alzheimer, Huntington, etc.) a ciertos factores en los datos y comenzar a desarrollar diagnósticos/terapias personalizadas. Manipular los datos biológicos es como un problema de traducción, como el Google Translate. La base de datos biológicos es HLI, y todo el mundo entra en ella. Los conjuntos de datos creados incluyen lo siguiente:

Genómica: Los 3.2 mil millones de nucleótidos de madre igual de su padre.
Microbioma: El genoma de los 100 billones + microorganismos de nuestro cuerpo.
La MRI/Imagenología: imágenes detalladas del cerebro, los órganos y el cuerpo.
Metabolome: Los 2.300 moléculas en el torrente sanguíneo.
Datos de Salud Fisiológica: Todos los datos de nosotros mismos: signos vitales, niveles de glucosa en sangre, los micro ARN en la circulación sanguínea, la frecuencia cardíaca, VO2 …
Si traducimos todos estos datos obtendremos un resulado de tu salud. Similar a cómo Google Translate actúa.
—————-
El Traductor de Google (GT) usa un proceso llamado traducción automática estadística, lo que significa que GT genera traducciones basadas en patrones que se encuentran en grandes cantidades de texto escrito. En vez de enseñar a la computadora todas las reglas de todos los idiomas, este enfoque permite que ella descubra las normas por sí misma en base a los patrones estadísticos significativos en los datos. Una vez que halla estos patrones, puede usar este “modelo” para traducir el texto similar en el futuro. Asi traduce en 90 idiomas diferentes. El reto ahora es usar lo mismo con la Genética, los registros de salud, y nos encontramos a la persona perfecta para liderar este esfuerzo: Franz Och – el hombre responsable de la construcción de Google Translate. “La gran misión es aprender a interpretar el genoma humano y ser capaces de predecir cualquier cosa que nos pasa a partir del código fuente”.
—————-
HLI está buscando ahora mismo lo siguiente: fuertes ingenieros de software que pueden construir de alta calidad, software fiable y de alto rendimiento, Expertos de aprendizaje automático y Estadísticas expertos. Aqui puede aplicar: http://www.humanlongevity.com/careers/open-positions/

ñada su visión …

See on Scoop.itNovedades Cientificas y Médicas

La evolución hoy

18 agosto, 2015

EL PAPEL DE LA EVOLUCIÓN HOY
————————–
Parece lógico pensar que la sabia evolución, la cual sólo se preocupó de mantenernos sanos, con el objetivo de lograr la reproducción mas óptima y así, en teoría, lograr el mejor producto para la próxima generación venidera, fue todo un éxito. Asi logramos conseguir y garantizar la mejor evolución de nuestra especie, como tal. El papel de la evolución en todo este lento desarrollo como especie, fue esencial, simple y efectivo. Así la evolución nos llevó a producir los Galileos, Newton, Einstein, Darwin, etc. que nos pusieron a la altura de la ciencia que hoy ya conocemos. La frutilla de esta torta evolutiva fue puesta por la aparición y desarrollo de dos áreas que cambiaron las reglas: 1) la Genética en la biología posibilitó trascender a la evolución o manipularla y 2) el avance de la computadoras y la Inteligencia artificial que nos catapultan en el manejo de datos, rapidez y eficiencia de los conocimientos.
————
Llegados a este punto, donde nos es posible programar una biología humana mejor a la que ya tenemos, sin la necesidad de recurrir a los millones de años que tuvimos que invertir con la evolución natural para llegar al punto en que estamos. Es claro que ahora, el proceso de nacer, crecer, reproducirnos y morir, parece haber dejado de tener un sentido o necesidad racional, a nivel biológico. La muerte ahora más bien, representa una demora en ese proceso de evolucionar: dejó de ser necesaria, como tantas otras cosas que la ciencia nos ha enseñado. A su vez, la Inteligencia Artificial en el área de la computación, ha mostrado el mejor camino para aprender más rápido y sin los errores humanos que tuvimos que superar en el pasado. Los algoritmos computacionales nos permitirán usar toda la información que ya tenemos y también la información futura que produzcamos y podremos sacar de ella, todas las conclusiones que necesitamos.
————
Esto era impensables hace unas pocas décadas. Pero hoy, todo parece indicar que ya sólo hace falta tomar consciencia de lo aqui expuesto y aplicar los recursos necesarios para obtener un desarrollo adecuado. El futuro próximo puede ser completamente distinto a lo que todos hemos creído. ¿Cuánto demoraremos en identificar el rumbo correcto y encender los motores?. No lo sabemos. Nuestra sociedad es un poco confusa aún y los medios de comunicación, manejados en su gran mayoría con criterios comerciales, no tienen suficientes conocimientos para manejar estos temas en el corto plazo. Es probable que, tal como ocurriera en el pasado, debamos esperar unas cuantas décadas de confusión y desvíos, para que al final, la sociedad en su mayoría, vislumbre hacia adonde ir y termine apoyando todas estas cuestiones. No será fácil ni rápido y estará plagado de anuncios apocalípticos, como todos los grandes cambios.
————
REF (ago 2015)

See on Scoop.itNovedades Cientificas y Médicas

Sepa como Envejece

7 abril, 2015

TENGA IDEA DE COMO ENVEJECE EL SER HUMANO
————————–
Cada vez vivimos más y en mejores condiciones, pero el proceso de envejecimiento comienza mucho antes de lo que imaginamos. La mayoría de los cambios vienen por el sedentarismo y mala alimentación. Otros son debido al desgaste celular que no reponemos. Un mejor conocimiento del envejecer, implica verlo como un proceso, para poder entender el radio de acción que tenemos hoy para llevar a cabo una vida con mayor calidad. El ritmo, los momentos y el como dependen de cada persona, de lo que ella haga día a día, de lo que sus padres y abuelos hicieron también durante su vida (herencia genética y epigenética).
———–
En general, podemos afirmar sin equivocarnos que las personas no son conscientes más que de los cambios más obvios (no pueden leer o van al baño muchas veces, etc.) pues en general, la persona media no sabe ni siquiera cuantas veces late su corazón por minuto, debido a que han sido criados y educados desconociendo toda esta información importante (ritmo cardiaco, colesterol, presión sanguinea, etc.) e incluso, en muchas culturas muy machistas, era un sintoma de debilidad o poca masculinidad el mostrar interés por estos temas. Hoy, tenemos otra visión sobre estos temas e incluso otra tecnología que nos ayuda: aparatos baratos y fieles que miden esos datos y en la comodidad de nuestras casas.
————-
He aqui un resumen de los cambios que se van produciendo con los años.

A LOS 18: 

– PIEL: LA PRODUCCIÓN DE COLÁGENO Y ELASTINA BAJA UN 1% AL AÑO: desde esta edad. La piel se vuelve más fina, pierde elasticidad, se seca más y se rasga con más facilidad. La persona no nota nada al principio, pues nuestra vista no es de lo mejor.

A LOS 20 AÑOS:
– CEREBRO: LA CANTIDAD DE NEURONAS COMIENZA A DESCENDER: Nacemos con más de 100.000 millones de neuronas, número que comienza a reducirse a los 20 años.

A LOS 25:
– PULMONES: DISMINUYE NUESTRA CAPACIDAD AERÓBICA a un ritmo de 10% cada diez años, o aún mayor, dependiendo de cuanto sedentarismo practiquemos.

A LOS 30:

– PIEL: LLEGAN LAS PRIMERAS ARRUGAS Especialmente en la zona de los ojos.
– RIÑONES: EMPIEZAN A FILTRAR PEOR LA SANGRE. Desciende el número de células, secretan demasiada agua y muy poca orina.
– HORMONAS: DESCIENDE GRADUAL LA PRODUCCIÓN DE TESTOSTERONA a un ritmo del 1% anual y esta hormona afecta muchas cosas, incluso hasta la personalidad.
– PULMONES: PIERDEN CAPACIDAD DEL 1% AL AÑO A PARTIR DE LOS 30. Se debilitan los músculos, desciende el número de alvéolos y obtenemos menos oxígeno del aire respirado. Son las primeras muestras del sedentarismo y sus efectos físicos.
– MUSCULATURA: COMIENZA A DISMINUIR LA MASA (Y FUERZA) MUSCULAR la que se reducirá más de un 10 al 25% en toda nuestra vida adulta. Otra consecuencia variable con nuestro nivel de sedentarismo.

A LOS 35: 

– EMPEZAMOS A PERDER CAPACIDAD AUDITIVA y a poner mayor volumen a radios, TV y al hablar más fuerte.
– LOS HUESOS EMPIEZAN A PERDER MASA ÓSEA a un ritmo del 1% al año. También influye el sentarismo.
– DESCIENDE LA FERTILIDAD. Baja el número y la calidad de óvulos y del esperma.

A LOS 40:

– CEREBRO: Pierde unas 10.000 NEURONAS al día lo que afecta a la memoria, coordinación y funciones superiores.
– ENCÍAS: retrocede levemente y los dientes se exponen más a restos de alimentos, también se desgasta el esmalte.
– EMPEZAMOS A PERDER ESTATURA (1 cm cada década). Los discos que separan las vértebras se estrechan, podemos llegar a perder entre 2,5 y 7,5 cm de estatura.
– VISTA: DE CERCA DISMINUYE pues la lente se vuelve más rígida, y cuesta enfocar objetos a menos de 60 cm.
– PIEL: ARRUGAS MÁS MARCADAS (LABIO SUPERIOR). La capa de grasa es más delgada, favorece la formación de arrugas y nos hace más sensibles al frío.
– CORAZÓN: MENOS Y MAYORES CÉLULAS MUSCULARES DEL CORAZÓN. El corazón tarda más en llenarse, las arterias se vuelven más rígidas y aumenta la tensión arterial.

-METABOLISMO: COMIENZO DE LOS PROBLEMAS DIGESTIVOS provocados por la mala dieta.

 A LOS 50: 

– OIDO: NOS CUESTA ESCUCHAR TONOS AGUDOS. Más difícil distinguir palabras.
– SENTIDOS: Disminuye el olfato y el gusto lo que afecta más a sabores salados y dulces que a los amargos o agrios. Esto puede aumentar el consumo de alimentos no saludables con exceso de sal o azucar.
– MENOS NEFRONAS, los riñones pierden capacidad de filtrado.
– METABOLISMO: Aumenta el nivel de azúcar en sangre, en ayunas: entre 6 y 14 mg/dL cada década.
– AUMENTA EL TAMAÑO DE LA PRÓSTATA, pasandose de ser una nuez/avellana al tamaño de una mandarina.
– VISTA: Ojos más secos. Podemos ver “moscas” por la solidificación de los fluidos.
– PIEL: Continua su decadencia y las arrugas son ahora más profundas. Aparecen las manchas de la edad, pues hay peor gestión del calor y cicatrización más lenta en la piel.
– EDAD MEDIA DE COMIENZO DE LA MENOPAUSIA: Se contraen ovario y útero, los tejidos de la vagina son menos elásticos y más secos.
– PÉRDIDA MÁS ACELERADA DE DENSIDAD ÓSEA POR LA MENOPAUSIA. Sobre todo en la cabeza del fémur, en las muñecas y las vértebras.

– PROBLEMAS DE ULCERAS, ACIDEZ, HERNIAS ESTOMACALES, ETC. debido a la mala dieta se pueden ver en un 50 % de hombres y mujeres.

 A LOS 55: 

– DEL 10 AL 25% DE LOS HOMBRES BAJA SU NIVEL DE TESTOSTERONA, lo cual provoca menos esperma, baja la libido, menor flujo sanguíneo al pene (erecciones más cortas o menos rígidas, mayor riesgo de impotencia).
– LOS HOMBRES GANAN PESO HASTA LOS 55. A partir de esa edad comienzan a cambiar la forma fisica de piernas, pecho, brazos debido al aumento notable de la grasa y perdida muscular.

-DISMINUYE LA CAPACIDAD CEREBRAL DE ANALIZAR: debido a que la memoria, la atención y la percepción fina de los cambios se van perdiendo. Hay tendencia a sufrir ansiedad, depresión y adquirir o apuntalar adicciones con las comidas, bebidas , etc.

A LOS 60:
– DESCIENDE EL NÚMERO DE CÉLULAS EN LA MÉDULA ESPINAL. No afecta a nuestra fuerza ni a nuestra sensibilidad.
– VEMOS PEOR CON LUZ TENUE. Una persona de 60 años necesita 3 veces más luz que una persona de 20 años, la lente es más densa, deja pasar menos luz.
– LAS VELLOSIDADES INTESTINALES SE “ALISAN”. Se absorben menos nutrientes, el movimiento es más lento y es más probable sufrir estreñimiento.

-LA TEMAS DE MEMORIA Y RELACIÓN DE COSAS SIGUE PERDIENDO CALIDAD

A LOS 65:

– PÉRDIDA GRADUAL DEL OÍDO.

– MAYOR RIESGO DE EROSIÓN Y PÉRDIDA DE DIENTES.
– AUMENTA EL RIESGO DE PADECER ENFERMEDADES CARDIOVASCULARES (ictus, infartos, etc.)
– SE REDUCE LA CELULARIDAD DE LA MÉDULA. Cuando nacemos el 80-100% de la
médula ósea está compuesta por células hematopoyéticas, a los 65 años sólo el 50%.
– RIESGO DE PADECER CATARATAS.
– LA MENOPAUSIA CONTRIBUYE A LA INCONTINENCIA. La falta de estrógenos hace que se debiliten los tejidos de la uretra y ello lleva, tanto en hombres como mujeres a tener olor a orin en su ropa interior (antes llamado “olor a viejo”).
– LAS MUJERES GANAN PESO HASTA LOS 65. Y luego empiezan a perderlo, el músculo magro es reemplazado por grasa.

A LOS 70: 

– CAMBIOS EN LA PERCEPCIÓN DE LOS COLORES. La lente se amarillea, los colores pierden brillo y es más difícil ver los contrastes.
– MENOR CAPACIDAD PULMONAR. Un hombre de 70 años inhala medio litro de aire en una bocanada, la mitad que uno de 30. El efecto varía de acuerdo al sedentarismo que viva la persona.
– INCONTINENCIA URINARIA. Una persona de 70 años tiene la mitad de capacidad que una persona de 30 años. El típico olor a viejo o vieja (orin en la ropa interior) se intensifica por estos motivos si la persona no presta atención a ello.
– SE REDUCEN SUTILMENTE ALGUNAS TAREAS MENTALES. vocabulario, memoria a corto plazo y la habilidad de aprender sufren las consecuencias.
– EL HÍGADO SE HACE MÁS PEQUEÑO. Sus células, con gran capacidad de regenerarse, son cada vez menos y su trabajo pierde eficacia, los efectos de los fármacos se vuelven más duraderos.

A LOS 75:
– PÉRDIDA DE VISIÓN PERIFÉRICA. Entre los 70 y los 80 años perdemos entre 20º y 30º de visión periférica.

– LOS RIÑONES ya filtran la mitad de sangre que una persona de 30 añós.
– UN 30% DESARROLLA MÁS CARIES DE RAÍZ.
– MAYOR PROPORCIÓN DE GRASA MUSCULAR. Proporcionalmente se tiene 2 veces más grasa que al principio de la vida adulta, la que se distribuye de otra manera y cambia la forma del torso.

A LOS 80:

– DIFICULTAD PARA DISTINGUIR SOMBRAS Y PERCIBIR LA PROFUNDIDAD.
– LAS OREJAS Y LA NARIZ NUNCA DEJAN DE CRECER. Las orejas crecen a un ritmo de 0,22 mm por año lo que es mas o menos 1cm en 50 años.
– EL 50% SUFRE PÉRDIDAS DE AUDICIÓN.

———————–

Las diferencias en las esperanza de vida, si se mira bien son mínimas. ¿Cuánto más vive un japones que un Argentino?. Pongamos que 7 años en promedio, como mucho y unos 4 años más que un norteamericano. Todo muestra que hemos llegado a un techo y para superarlo, necesitamos una visión diferente del tema. Es claro que la vejez es dañina e implica cambios en el metabolismo que conducen a un deterioro progresivo del cuerpo. Pero esos daños, quizás se puedan reparar dentro de un tiempo. Con mejor mantenimiento, hoy ya podemos permanecer más tiempo saludables. Esto es facil de comprender.
—————–
Los daños basicamente se producen por las mutaciones nucleares y mitocondriales a nivel celular. La especie de basura molecular que va produciendo el metabolismo, tanto en el interior como exterior de las células son posiblemente causantes de problemas (Alzheimer, problemas inmunes, diabetes, etc.). También la pérdida de la elasticidad de las conexiones celulares también tienen su efecto. El medio ambiente en que vivimos y nuestros hábitos diarios también hacen su parte. La ciencia siempre a ido en contra de la naturaleza: el auto nos impide caminar, las vacunas nos impide enfermarnos, etc. Esa es la base de nuestro progreso científico y la que nos permite vivir vidas más largas y plenas hoy. Renegar de ello no tiene sentido, asi como cuestionarlo.
—————–
Es claro que el cerebro está hecho de la misma materia que el resto del cuerpo: esto es celulas y más celulas. Si nuestro cuerpo se mantiene mejor o logra rejuvencer, también lo hará nuestro cerebro. A las personas normales, siempre les va a resultar mucho mejor vivir entre una población activa y sana que hacerlo en sociedades envejecidas y enfermas. La vejez es una masacre, dijo alguna vez Woody Allen. Creo que tenía razón.
—————–

See on Scoop.itNovedades Cientificas y Médicas

Drogas senolytics para la vejez

12 marzo, 2015

TRATAR LA VEJEZ CON AGENTES SENOLYTICS
—————–
En el 2015, un equipo de investigadores del Instituto de Investigación Scripps (TSRI), de la Clínica Mayo y otras instituciones ha identificado una nueva clase de fármacos que en modelos animales ralentiza considerablemente el proceso de envejecimiento, el alivio de los síntomas de fragilidad, la mejora de la función cardíaca, y la ampliación de una vida saludable. Hallaron 2 drogas – el medicamento contra el cáncer dasatinib (vendido bajo el nombre comercial Sprycel ) y quercetina, un compuesto natural que se encuentra en frutas, verduras, muchas hojas y granos y también se vende como un suplemento que actúa como un antihistamínico y antiinflamatorio – pueden matar las celulas senescentes. Estas son células que han dejado de dividirse y acumular con la edad, lo que acelera el proceso de envejecimiento. Los científicos acuñaron el término ” senolytics ” para esta nueva clase de medicamentos.
—————
Estos compuestos inducen selectivamente la muerte de las células senescentes. Los dos compuestos tenían diferentes puntos fuertes: el dasatinib ELIMINA LAS CELULAS SENESCENTES progenitoras de células grasas humanas, mientras que la quercetina es más eficaz contra las CÉLULAS SENESCENTES ENDOTELIALES humanas y células madre de la médula ósea de ratón. Una combinación de los dos era más eficaz en general. En modelos animales, los compuestos mejoran la función cardiovascular y la resistencia al ejercicio, la reducción de la osteoporosis y fragilidad y ayudan con una healthspan o vida saludable prolongada, dijo Niedernhofer, cuyos modelos de envejecimiento acelerado de los animales se utilizaron ampliamente en el estudio. “Sorprendentemente, en algunos casos, estos fármacos lo hicieron con un solo curso de tratamiento”. Aún se necesitan más pruebas antes de su uso en humanos, pues estos farmacos tienen posibles efectos secundarios, por lo menos con el tratamiento a largo plazo.
———-
Los investigadores, sin embargo, siguen siendo optimistas sobre el potencial de sus hallazgos. “La senescencia está involucrado en una serie de enfermedades y patologías lo que podría haber cualquier número de aplicaciones para estos compuestos y similares,” dijo Robbins. “Además, esperamos que el tratamiento con medicamentos senolytic para eliminar las células dañadas sería poco frecuentes, lo que reduce el riesgo de efectos secundarios.”
El healthspan de ratones se ve reforzada por la eliminación de células senescentes utilizando un gen suicida transgénico. La consecución de los mismos utilizando pequeñas moléculas tendría un tremendo impacto en la calidad de vida y la carga de las enfermedades crónicas relacionadas con la edad. Aquí se describe la justificación para la identificación y validación de una nueva clase de fármacos denominados senolytics, que matan selectivamente células senescentes.
————
Estos medicamentos estan dirigidos a estos factores eliminando selectivamente las células senescentes: dasatinib elimina las senescentes progenitoras de células grasas humanas, la quercetina es mejor contra las células endoteliales humanas senescentes y las de ratón BM-MSC. La combinación de dasatinib y quercetina fue eficaz en la eliminación de MEFs senescentes. En vivo, esta combinación reduce carga de células senescentes en edad cronológica, la radiación expuestos, y progeroide ERCC1-/Δ en ratones. En ratones viejos la función cardiaca y vascular de la carótida se mejoró en 5 días después de una sola dosis. Una dosis única condujo a más capacidad de ejercicio al menos por 7 meses después del tratamiento de drogas. La administración periódica extendió el healthspan en ERCC1-/Δ en ratones (retrasa los síntomas relacionados con la edad: osteoporosis y pérdida de proteoglicanos del disco intervertebral).
————

See on Scoop.itNovedades Cientificas y Médicas

Trazan 1er. Mapa Epigenético

18 febrero, 2015

If the genome is the musical score of life, the epigenome is how the orchestra goes about playing it.

Source: www.washingtonpost.com

CARTOGRAFÍA DEL EPIGENOMA HUMANO
—————-
El epigenoma humano es lo que hace que un gen no dependa solo de su secuencia (gattacca), sino que hay otras cosas que pueden influir sobre esto (de ahí el agregado de “epi”, el que literalmente significa “encima de”), como son los grupos más sencillos de la química orgánica (metilo, CH3) y ciertas proteínas especializadas en empaquetar el ADN llamadas histonas. Esto explica que aunque todas las células tengan el mismo genoma, unas se conviertan al final en células de la piel, otras en neuronas y así hasta los más de un centenar (111) de tipos celulares especializados, o diferenciados, que constituyen el cuerpo humano.
—————–
Los investigadores han lanzado la cartografía más completa del epigenoma humano hasta la fecha, utilizando el análisis masivo de datos para entender cómo y por qué los genes se pueden apagar y encender en las células humanas. Su trabajo, publicado el miércoles en la revista Nature , podría conducir a nuevos tratamientos para una multitud de enfermedades, incluyendo el cáncer. Este macroproyecto revela hoy el mapa epigenómico humano, que localiza dónde están esas modificaciones (metilos, histonas) en todos los tipos celulares importantes del cuerpo humano y también en 58 enfermedades (genéticamente) complejas. Como pasó con el proyecto Genoma Humano, la información se hará pública y gratuita para todo el mundo.
————–
Los investigadores y el profesor del MIT Manolis Kellis analizaron un total de 150.000 millones de Secuenciaciónes del Genoma. Se uso de un algoritmo especialmente desarrollado, para ver este conjunto de datos de forma masiva y buscar cambios epigenómicos en 111 tipos de células diferentes. La tarea de secuenciación se lleva a cabo bajo un programa de investigación de 10 años del Gobierno estadounidense, el Programa de Hoja de Ruta de Epigenómica, lanzado en el 2008 con un financiamiento de 240 millones de dólares y asi se llegó a estos interruptores moleculares que pueden encender o silenciar genes individuales en el ADN en más de 100 tipos de células humanas
Las diferentes combinaciones de marcas epigenéticas caracterizan diferentes regiones del genoma, lo que refleja las funciones específicas que desempeñan en cada célula, nos dice Kellis.
————-
Al estudiar estas combinaciones sistemáticamente, podemos aprender el idioma del epigenoma y lo que nos dice de su actividad y función en cada región genómica y en cada uno de los tipos de células. En uno de los estudios publicados los investigadores ataron cambios celulares específicos a 58 rasgos biológicos diferentes. A veces los cambios epigenómicos de una célula revelan posibles pistas sobre una enfermedad. Como ejemplo, se encontraron mutaciones asociadas con el Alzheimer que cambian la actividad genómica de las células inmunes, no sólo de las células cerebrales. Esto se halló en un modelo de ratón, por lo que podría no aplicarse a nosotros, pero si lo hace, daría nuevas áreas para tener en cuenta cuando se intenta tratar la enfermedad.
————–
La numerología del proyecto escapa al ámbito de las grandes cifras: más de 100 tejidos primarios y tipos celulares, 2.800 experimentos cada uno a escala del genoma entero, 150.000 millones de sondas o fragmentos de ADN que cubren el genoma 3.000 veces. Ahora ya pueden ver que, las variantes genéticas asociadas a la diabetes de tipo 1, la artritis reumatoide y la esclerosis múltiple están activas en las células del sistema inmune. Y esto es lógico, puesto que esas tres enfermedades pertenecen a la categoría autoinmune, es decir, que están causadas por un funcionamiento anómalo o excesivo de las defensas, que se dedican atacar a las células pancreáticas, articulares o nerviosas del propio paciente. Pero la lógica no sirve para encontrar tratamientos, y lo que tenemos ahora son datos duros que sí lo permitirán.
————
En la misma línea, las variantes genéticas asociadas con la presión arterial están activas en las células del corazón, las asociadas con un alto nivel de colesterol y por ello, asociadas con una probabilidad incrementada de infarto, funcionan en el hígado, como las asociadas a los trastornos metabólicos. Todo esto tiene su lógica también. Los datos obtenidos y no la pura lógica, será lo que permitirá avanzar en el conocimiento de estas enfermedades y buscar tratamientos eficaces. En el alzhéimer, puesto que se trata de una enfermedad neuro-degenerativa (que va matando neuronas progresivamente) cabría esperar que las variantes genéticas que lo favorecen estén activas en las neuronas, causando asi la acumulación de proteínas tóxicas amiloides, pero parece que no es así. Esas variantes funcionan en las células del sistema inmune: en concreto en las células denominadas monolitos CD14. Esto cambia por completo la perspectiva para investigar tratamientos preventivos o paliativos del alzhéimer.
————–

Los científicos ahora tendrán que descifrar cómo el epigenoma afecta los genes, y también determinar cómo la vida que llevan las personas puede afectar su epigenoma. Una vida de factores ambientales y de hábitos de vida, son los que influyen en el epigenoma, como fumar, hacer ejercicio, hábitos alimenticios, exposición a químicos tóxicos e incluso la crianza. Esto es poner la salud practicamente en sus manos.

¿Qué tiene la medicina hoy para mi?

29 enero, 2015

¿QUÉ TIENE LA MEDICINA HOY PARA MI?
——————–
La medicina de hoy 2015, no la del año 2000, tiene muchas cosas positivas para usted. El gran inconveniente es que usted aún no se ha enterado de nada. Considere por unos momentos algunas cosas que usted seguramente ha subestimado:

a) los 70 mg de aspirina diaria para prevenir ataques al corazón
b) los factores de riesgo modificables, como el nivel de colesterol y la presión sanguinea
c) los riesgos manejables cardíacos, de cancer, de alzheimer, repito, riesgos manejables por usted como el tabaquismo, sedentarismo y la dieta.
d) el analisis genético que le avisa que farmacos no tomar, de que cosas debe cuidarse, de que debe hacer si quiere perder peso o mantener musculo…en fin.
Hay muchas cosas que a usted se le pasaron por alto. Como sucedió en tantas otras áreas del conocimiento.
—————–
Si quiere enterarse más sobre estos temas y sobre lo que está en sus manos y que realmente puede hacer hoy, esta en un libro hecho para mostrarselo (www.createspace.com/5034300)…sólo que usted, al igual que dije antes…AÚN NO SE ENTERÓ!.

See on Scoop.itNovedades Cientificas y Médicas

Alargar Telomeros revierte la vejes celular

23 enero, 2015

Researchers delivered a modified RNA that encodes a telomere-extending protein to cultured human cells. Cell proliferation capacity was dramatically increased, yielding large numbers of cells for study.

Source: med.stanford.edu

NUEVA FORMA DE ALARGAR LOS TELOMEROS
————————-
Repasando para usted. Los telómeros son las tapas de protección de las repetidas secuencias de ADN que se encuentran en el extremo de los cromosomas. La Longitud de los telómeros es una parte del sistema de regulación que evita que las células se dividan de forma indefinida: un poco de longitud se pierde con cada división celular y la célula destruye a sí misma o deja de dividirse cuando sus telómeros se vuelven demasiado cortos.
———-
La enzima telomerasa se activa para mantener los telómeros largos añadiendo secuencias repetitivas adicionales a los extremos, lo cual también lo hace el cáncer y asi logra división celular indefinida. Los investigadores han alargado la vida saludable en ratones impulsando la actividad de la telomerasa a través de la ingeniería genética, aunque aún de porque alarga la vida: ¿es una cuestión de más actividad de células madre, un efecto secundario de tener telómeros largos tales como aumento de la duración de la vida celular, u otro aspecto de la telomerasa, tales como su influencia en la biología mitocondrial?. Hay un considerable interés en explorar lo que sucede cuando se alargan los telómeros y es inevitable que se desarrollen mejores métodos de alargamiento.
———-
Un nuevo procedimiento rápido y eficaz implica el uso de un tipo modificado de ARN, que mejorará la capacidad para generar grandes números de células para estudiar o desarrollar fármacos. El ARN usado en este experimento contenía la secuencia codificante para TERT, el componente activo de origen natural de la enzima telomerasa. La telomerasa se expresa por las células madre, incluidas las que dan lugar a espermatozoides y óvulos, para asegurar que los telómeros de estas células permanezcan en forma. La mayoría de los otros tipos de células, sin embargo, expresan niveles muy bajos de telomerasa. Las Células de la piel y musculares con telómeros alargados por el procedimiento fueron capaces de dividir hasta 40 veces más que las células no tratadas. La investigación podría apuntar a nuevas formas de tratar enfermedades causadas por el acortamiento de los telómeros.
——————
La técnica desarrollada tiene una ventaja importante: es temporal. El ARN modificado está diseñado para reducir la respuesta inmune de la célula para el tratamiento y permitir que el mensaje de TERT se disipa y desaparece al cabo de unas 48 horas. Luego los telómeros recien alargados comienzan a acortarse de nuevo con cada división celular. Los intentos anteriores para entregar ARNm que codifique el TERT provocó una respuesta inmune contra la telomerasa, lo que podría ser perjudicial. Por el contrario, nuestro técnica es no inmunogénica . Los métodos existente transitorios de extender los telómeros actúan lentamente, mientras que nuestro método actúa en unos pocos días y revierte el acortamiento de telómeros de más de una década de envejecimiento normal. Esto nos dice que un tratamiento sería breve y poco frecuente.
———-
http://med.stanford.edu/…/telomere-extension-turns-back-agi…

See on Scoop.itNovedades Cientificas y Médicas

Cómo vivir más y mejor usando la epigenética

30 octubre, 2014

“Cómo Vivir más y mejor” Use la epigenética
Comprelo en: https://www.createspace.com/5034300

HE AQUI ALGUNOS PASAJES: “Este libro le acercara lo último que sabemos en Genética, epigenética, células madre, nanotecnología, medicina preventiva, anti-envejecimiento, dietas y prácticas de ejercicio físico, dejando de lado todo lo que no pudo demostrarse cientificamente en el laboratorio…”.

“…una cosa importante para usted es que no necesariamente debe seguir a miles de millones de personas que se niegan a mejorar y van resignadamente al matadero…pues el tiempo pasará igual, sin importarle en que lugar se colaca usted.”…

La ignorancia y hábitos poco saludables le robará de 5 a 15 años de vida saludable…”.

Vea video en youtube https://www.youtube.com/watch?v=8zyrLWkt8qw

See on Scoop.itNovedades Cientificas y Médicas

Estrategía SENS ¿Qué es?

26 febrero, 2014

See on Scoop.itNovedades Cientificas y Médicas

En el gráfico se muestra lo que esta linea de investigación, llamada SENS, considera las causas del envejecimiento humano y con que terapias puede combatirse cada uno de ellos. Mas abajo detallamos y hablamos un poco de cada una de ellas para tener mejor idea sobre lo que significa este tema.

Refernan Ref‘s insight:

Sigue un listado de estas 7 causas y su estado actual-

1) AmyloSENS: extracción de basura intercelular

La forma más conocida de basura extracelular es la beta-amiloide: que forma placas en los cerebros de los pacientes con la enfermedad de Alzheimer, y también (más lentamente) en todos los demás, y deteriora la función cognitiva. También hay una variedad de agregados similares que se forman en otros tejidos durante el envejecimiento y contribuiyen a enfermedades relacionadas con la edad, incluyendo amiloide de islotes en la diabetes II y la amiloidosis cardíaca senil, la cual es un importante contribuyente a la insuficiencia cardíaca. De hecho, hay cierta evidencia de que la amiloidosis cardíaca senil puede ser la principal causa de muerte en las personas que sobreviven más allá de 110 años de edad.

La solución

Los Agregados extracelulares pueden ser removidos desde el cerebro y otras áreas del cuerpo por anticuerpos especializados que apunten en concreto sobre ellos y los eliminen del tejido. Hay dos formas principales para introducir estos anticuerpos: vacunas “activas” y “pasivas”. Las vacunas activas introducen un pequeño fragmento del amiloide para estimular a las células del sistema inmune al ataque. Las vacunas pasivas implican realizar los anticuerpos fuera del cuerpo e introducirlos a través de la inyección.

Más recientemente, una prometedora variación de este enfoque ha sido desarrollado. Dr. Sudhir Paul de la Universidad de Texas Medical School en Houston, que descubrio que un subconjunto de anticuerpos humanos tienen actividad catalítica frente a un antígeno en particular, lo descompone en fragmentos pequeños y menos dañinos en lugar de atraparlo para la eliminación o destrucción por otras células inmunes.  Vacunas contra los amiloides son actualmente investigadas. De hecho, varias vacunas dirigidas a la beta-amiloide se encuentran actualmente en ensayos clínicos avanzados, y otros se encuentran en distintas etapas de la investigación con animales. El más ambicioso de estos ensayos es la Iniciativa de Prevención del Alzheimer : un niño de cinco años y $ 100 millones de pruebas de estudio para ver si la vacuna del beta-amiloide puede prevenir la enfermedad en las personas cuyos genes hacen que se producen más beta-amiloide que la mayoría de la gente, y que, por tanto, desarrollar la enfermedad de Alzheimer a una edad mucho más joven que el resto de nosotros.

2) ApoptoSENS: Eliminación de las células disfuncionales

Nuestras células a veces ellos se desvían lejos de su normal destino. El número de estas células en los tejidos aumenta gradualmente con el tiempo, hasta que por nuestra quinta década empiezan a alcanzar niveles que son perjudiciales para la función del tejido normal (tenemos células senescentes clasicas, células del tejido graso, células inmunes).  .

La Solución

Cada uno de estos diversos tipos de células anormales se producen en diferentes tejidos, y los problemas que causan son distintos el uno del otro. Sin embargo, hay 2 estrategias básicas que puede ser usada para eliminarlas: Desarrollar un medicamento que es tóxico para las células no deseadas, o que les hace cometer suicidio, pero que no hace daño a las células sanas, normales, oEstimular el sistema inmunológico para buscar y matar selectivamente las células diana.

En la Universidad de Arizona, la Fundación de Investigación SENS está financiando la investigación para restaurar la salud del sistema inmune en los ratones que envejecen, aumentando al mismo tiempo la capacidad de producir nuevas asesinas células T, dejando margen para ellos purgando células defectuosas desde el sistema.

3) GlycoSENS: entrecruzamientos extracelulares 

El buen funcionamiento de tejidos se basa en proteínas constituyentes que mantienen su estructura adecuada. Tales proteínas son responsables de la elasticidad de la pared de la arteria, la transparencia de la lente del ojo, y la alta resistencia a la tracción de los ligamentos, por ejemplo. Pero ocasionalmente, el azúcar en la sangre (y otras moléculas en los fluidos en el que se bañan estos tejidos) reaccionarán con estas proteínas, creando enlaces químicos denominados enlaces cruzados (Crosslinks) que actúan como moleculas “esposas”, tomando dos proteínas vecinos que antes eran capaces de moverse independientemente uno del otro y unirlos, deteriorando su función en la misma forma que ocurre con los participantes en una carrera de tres piernas.

En el caso de la pared de la arteria, por ejemplo, la reticulación de las cadenas de la proteína colágeno impide separar una de la otra para acomodar el aumento del pulso por la acción de bombeo del corazón. A medida que más y más cadenas de colágeno se vuelven reticuladas con el tiempo, los vasos sanguíneos se vuelven cada vez más rígido, lo que lleva a un aumento gradual de la presión arterial sistólica con la edad. Con la pérdida del efecto amortiguación proporcionado por el colágeno, el movimiento libre en los vasos sanguíneos, la fuerza de la oleada de sangre que es impulsada dentro de las arterias por la acción de bombeo del corazón, llega directamente a órganos como los riñones y el cerebro, provoca daños a las estructuras que filtran la sangre y que conecte las regiones funcionales de nuestro cerebro, y nos pone en riesgo de un accidente cerebrovascular. Además del daño químico también hay daños mecánicos. Una forma sutil de los daños mecánicos que probablemente contribuye a la rigidez de las grandes arterias y de otros órganos como el pulmón a través del tiempo es el desgaste y rotura de estructuras hechas de la proteína elastina elástica.

La Solución

Afortunadamente, los entrecruzamientos que se producen como accidentes químicos en nuestros tejidos estructurales tienen estructuras químicas muy inusuales, que no se encuentran en las proteínas u otras moléculas que el cuerpo produce a propósito.  Esto debería hacer posible la identificación o drogas de diseño que pueden reaccionar con los enlaces cruzados, sin romperse ningún transeúntes estructurales esenciales.

De hecho, hace varios años un grupo de químicos parecía haber encontrado una molécula de este tipo: una droga llamada alagebrium (o ALT-711 ), lo que reduce sustancialmente la presión arterial en el envejecimiento o diabéticos, además de varios otros efectos beneficiosos en animales, pero en humanos, los efectos eran leves y limitados. Esto puede ser debido a que el tipo de reticulación que alagebrium Severs es mucho más raro en los seres humanos de lo que es en roedores y otros animales de experimentación, o tal vez porque el fármaco tiene propiedades beneficiosas adicionales en animales que se extienden más allá de las reticulaciones se rompen que son menos importantes en los seres humanos.
Ahora se sabe que el que más contribuye a la reticulación de colágeno en seres humanos es una molécula llamada glucosepane, y los fármacos que escinden esta molécula es probable que tengan el efecto rejuvenecedor más fuerte en la elasticidad de los tejidos. Pero glucosepane puede ser una molecula demasiada compleja para ser rota por medicamentos. Por lo que algunos nuevos enfoques merecen explorarse, como por ejemplo, la ingeniería de enzimas, en lugar de las drogas, para romper los enlaces cruzados.

4) LysoSENS: Eliminar residuos fuera de las células

Las células tienen una variedad de sistemas para la descomposición y el reciclaje de estos materiales no deseados. Uno de estos sistemas es el lisosoma, una especie de “incinerador” celular que contiene las enzimas más poderosas de la célula para romper las moléculas destrozados en pedazos manejables. Sin embargo, a veces estos componentes están tan fusionados que ni siquiera el lisosoma es capaz de separarlos. Y si hay algo que no se puede descomponer en el lisosoma, no hay otro lugar para que vaya: sólo se queda allí hasta que el lisosoma rompe desastrosamente, o la propia célula es destruida.

Pero a medida que los macrófagos consumen más y más de estos materiales tóxicos, los lisosomas se congestionan con subproductos que no pueden romper. Con el tiempo, dejan de funcionar, y, o bien se convierten en disfuncionales en la pared de la arteria, o mueren de plano.
Esta acumulación de macrófagos enfermos y muertos en la pared de la arteria es la base de la aterosclerosis, las placas en las arterias que son responsables de la enfermedad cardíaca. A medida que sus números aumentan gradualmente con el tiempo, las olas de lesiones y se encona hasta que finalmente estalla, arrojando coágulos y otros materiales que provocan los ataques cardíacos y accidentes cerebrovasculares.

La Solución

Puesto que la raíz del problema es que el lisosoma es incapaz de descomponer todos estos productos de desecho difíciles, la solución más directa es para que les suministren nuevas enzimas que pueden degradar los desechos. Y, afortunadamente, sabemos que existen enzimas capaces de descomponer estos materiales – en concreto, en las bacterias y hongos del suelo que ayudan a descomponer los cadáveres.  Si no existieran tales enzimas, entonces el planeta estaría hasta los tobillos en desechos lisosomales no degradados sobrantes de las células de los 600 millones de años de la vida animal en el planeta.  Así que identificar las enzimas que estos organismos usan para digerir los desechos lisosomales, modificarlos para trabajar en el entorno del lisosoma humana, y luego entregarlos a donde tienen que ir en nuestras células.

5) MitoSENS: Prevenir daños por mutaciones mitocondriales

Las mitocondrias son las máquinas que viven dentro de las células y actúan como sus “plantas de poder”, convierten los nutrientes ricos en energía, los alimentos en ATP, la forma de energía que directamente alimenta las reacciones bioquímicas en la célula. A diferencia de cualquier otra parte de la célula, las mitocondrias tienen su propio ADN (mtADN), separado del ADN en el núcleo de la célula, donde se mantienen todo el resto de nuestros genes.

Las mitocondrias generan residuos tóxicos al generar energía de los alimentos que quema como combustible, escupiendo moléculas reactivas llamadas radicales libres, que pueden dañar las estructuras celulares. Y el ADNmt es especialmente vulnerable a estos radicales libres, ya que se encuentra tan cerca del centro de su producción.

La Solución

la estrategia MitoSENS es aceptar que las mutaciones mitocondriales pasen, pero diseñar un sistema que evite el daño que causan a la célula. Podemos hacerlo poniendo “copias de seguridad” de los genes mitocondriales en el núcleo, donde no puedan ser dañados por los radicales libres generados en la mitocondria. De esta manera, incluso si se eliminan los genes originales de la mitocondria, las copias de seguridad será capaz de proporcionar las proteínas necesarias para mantener la producción normal de energía en marcha, permitiendo que las plantas de energía celular siga con normalidad. Este enfoque se denomina expresión allotopic de las proteínas. Hoy en día, el ADN mitocondrial contiene instrucciones para la construcción de tan sólo 13 proteínas que necesitan las mitocondrias.

6) OncoSENS: Hacer mutaciones cancerosas inofensivas

Hay dos tipos de daños que se acumulan en nuestros genes a medida que envejecemos: mutaciones y epimutaciones.Las mutaciones son daños a la secuencia de ADN en sí, mientras que epimutaciones son daños en el “andamiaje” que el ADN, el cómo y cuando los genes se excitan en la célula.

A efectos prácticos, ambas mutaciones y epimutaciones finalmente nos hacen daño de la misma forma: hacen que la expresión del gen anormal, ya sea aumentando o disminuyendo la cantidad de una proteína codificada por el gen que produce, mediante la alteración en las condiciones en que esa producción es activada, o mediante la alteración de la estructura y función de la proteína resultante en sí. Debido a sus efectos similares, un enfoque que evita las consecuencias negativas de estos cambios en la expresión génica se puede usar para hacer que los dos tipos de daños sea inofensivo, a pesar del hecho de que la base molecular de las mutaciones y epimutaciones son bastante diferentes.

Lo que la mayoría de la gente sabe acerca del cáncer, es que resulta de una serie de (epi) mutaciones que ocurren en secuencia en la célula, lo que conduce a su crecimiento descontrolado. Otros tipos de mutaciones (epi) también se producen en nuestras células con el tiempo, y algunos científicos se han preocupado de que estas mutaciones no causan cáncer (epi) también podrían contribuir de distintas maneras a la enfermedad relacionada con la edad y la discapacidad.

Pero hay buenas razones para creer que no hay suficientes de estas mutaciones que en realidad tienen un impacto significativo en nuestra salud. Esto se debe a la amenaza del cáncer de incluso, una sola (epi) mutación es tan grande que obliga al cuerpo a desarrollar defensas contra (epi) mutaciones que superan con creces lo que sería necesario para evitar una carga significativa de la no-cáncer (epi) mutaciones que se produzcan.

Una solución intermedia: Los fármacos que inhiben la telomerasa

El hecho de que el cáncer parece ser la única (epi) mutaciones relacionadas con la edad que perjudican nuestra salud, simplifica las cosas mucho. Así que a pesar de su diversidad, todas las células de cáncer comparten algo fundamental en común: son dependientes para su supervivencia de su capacidad para secuestrar la telomerasa (o, con menor frecuencia, ALT). Este hecho ha llevado a buscar drogas que inhiban la actividad de la telomerasa en las células cancerosas.

La terapia de fármacos inhibidores de telomerasa estaría limitada por dos factores: El primero es que algunos tipos de cáncer usan el mecanismo de ALT en lugar de la telomerasa para mantener sus telómeros largo y aqui inhibir la telomerasa no hará nada. El segundo es el hecho de que el cáncer se reproduce a una velocidad de vértigo, pero su código genético es tremendamente inestable, por lo que nuevas mutaciones aparecen constantemente en las células dentro del tumor. Como resultado, están tirando continuamente nuevas líneas de células cancerosas, cada uno de los cuales tiene un código genético ligeramente diferente y propiedades distintas.
Esto permite al tumor el poder de la evolución de superar las drogas. También explica por qué inicialmente se responde bien a la quimioterapia y muchos meses más tarde, una nueva forma desarrolla resistencia al medicamento. Esto haría que un fármaco que inhibe la actividad de la telomerasa, simplemente es probable que deje de funcionar.

hay una estrategía OncoSENS de último recurso que derrotaría todo el cáncer – totalmente y de forma permanente. Se inicia a partir de los mismos hechos claves de necesitar alargar sus telómeros y su adaptación al medicamento. Esta estrategia (que era el tema de la tercera mesa redonda SENS) se llama “Wilt“, y es parar el alargamiento de telomeros en todo el cuerpo, no solo en las células cancerosas.  En pocas palabras, el cáncer no puede explotar la telomerasa y ALT para mantenerse con vida, si no existen los genes que codifican la maquinaria!, y esto haría imposible crecer para los cánceres, a menos que se las arreglan para crear una telomerasa completamente nueva o un gen ALT de la nada – una posibilidad infinitamente improbable.

Hay dos problemas posibles aqui con esta solución: La primera es que aunque la mayoría de nuestras células no usan la telomerasa, algunas, especialmente las células madre, lo hacen y eliminar el gen significaría que estas células sanas se quedaría sin respaldo telomérica. Eso significaría que nuestras células madre ya no serían capaces de producir nuevas células para reponer los tejidos y los tejidos comenzarían a atrofiarse prematuramente.

De hecho, esto es exactamente lo que ocurre en la disqueratosis congénita, una enfermedad asociada con el mantenimiento de los telómeros inadecuados. Pero hay una manera de evitar este problema. La reserva de los telómeros de las células madre parece ser suficiente para mantener a las células normales por alrededor de una década. Así que para apoyar la capacidad de nuestros tejidos de renovarse indefinidamente, sería suficiente para reemplazar aquellos que fallan las reservas de células madre con células nuevas una vez por década. Y mediante el diseño de estas células madre frescas que no tienen telomerasa o genes de ALT de los suyos, pero para tener telómeros que son lo suficientemente largo cuando primero se trasplantaron a una persona para durar una década en la fuerza de los telómeros originales, nuestros tejidos haría siempre tienen las células madre funcionales que necesitan para el mantenimiento, pero las células madre presentes en el tejido en un momento dado serían simplemente incapaces de desarrollarse en cánceres potencialmente mortales.

El otro problema potencial a la estrategia WILT sería si la telomerasa o ALT tenían alguna función esencial que no sea el alargamiento de los telómeros, por lo que la eliminación de los genes para su maquinaria podría también comprometer alguna otra función, esencial. Se han realizado algunos estudios, el más riguroso hasta hoy, sugiere fuertemente que no hay otras funciones al alargamiento de telómeros de la telomerasa.

7) RepleniSENS: Sustitución de las células perdidas

Cada día nuestras células son dañadas. Algunas son reparadas, pero otras son destruidas o forzadas a cometer suicidio (apoptosis) por el bien del cuerpo. El resultado neto es que en el transcurso de décadas, los tejidos de larga duración como el cerebro, el corazón y los músculos esqueléticos comienzan a perder progresivamente células, y su función se ve cada vez más comprometida. Los músculos se debilitan, el cerebro pierde neuronas, y eso contribuye al deterioro cognitivo y la demencia, así como a la pérdida de control sobre los movimientos de los músculos finos (un proceso que termina en la enfermedad de Parkinson).

El timo – que es una glándula en el esternón, donde una clase importante de las células inmunes maduras – se contrae, haciendo que seamos más vulnerables a las enfermedades infecciosas pues se producen menos células inmunes frescas. El deterioro del timo con la edad es una de las dos razones principales (junto con la acumulación de células defectuosas) por qué llegamos a ser cada vez más vulnerables a la gripe, la neumonía y otras enfermedades infecciosas a medida que envejecemos.
La ingeniería de tejidos del timo sana y joven ayudaría a restablecer la respuesta inmune vigorosa de la juventud. En la Wake Forest University Institute de Medicina Regenerativa, la financiación de la Fundación de Investigación SENS está ayudando el laboratorio del Dr. John Jackson intensificar la investigación sobre la ingeniería de un nuevo timo, con el fin de restaurar la función inmune juvenil.
La división celular es estimulada naturalmente en algunos músculos por el ejercicio, pero el mayor volumen de tejido muscular y la fuerza es el resultado de aumentar el tamaño de las células, en vez de agregar nuevas células al tejido. Estos procesos también pueden ser estimulados artificialmente via inyección de esteroides anabólicos y otros factores de crecimiento, pero con efectos secundarios, como el cáncer.

La Solución

La terapia celular y la ingeniería tisular, la ciencia de cultivar órganos para trasplante en un andamio biodegradable artificial fuera del cuerpo. Los fundamentos de esta forma de medicina se encuentran en el trasplante de órganos y tejidos que ya utilizamos para reemplazar la sangre de los pacientes de quimioterapia o de los riñones de los pacientes en diálisis.  Pero aún el potencial terapéutico se ve limitada por el número limitado de órganos y células para trasplante y además, el trasplante produce un rechazo y ataca el tejido donado. Esta reacción inmune tiene que ser suprimida con fármacos de por vida.

Dos nuevas tecnologías repleniSENS harán de estos problemas una cosa del pasado. Estas tecnologías permiten que nuevas células y órganos se hagan a la medida para el destinatario, a partir de sus propias células. Esto elimina la necesidad de donación y el rechazo.
Los científicos comienzan con células maduras (como la piel o las células sanguíneas) extraídas de la persona y restauran en ellas los poderes perdidos de las células madre embrionarias: al transformar el tipo de célula y para mantener la reproducción inevitablemente.

El primer método implica: reprograma las células del estado de madurez en el estado embrionario generando “células madre pluripotentes inducidas”, una variante de este método permite tomar células que son de un tipo diferente de las células que se necesitan, pero presentes en el mismo tejido y reprogramarlas a las células necesarias sin pasar por el estado embrionario. Se usaron asi células de la piel para transformarlas en células musculares del corazón.  El segundo método crea nuevas células similares a las embrionarias a partir de células adultas, fusionando un óvulo de una donante con células de la persona que necesita células, usando la técnica experimental de transferencia nuclear de células somáticas (o “clonación terapéutica”).

Cómo aplicar estas terapías de Rejuvenecimiento Biotecnologico

Las proteínas por lo general no se puede dar en forma de píldora, tienen que ser inyectadas, lo que puede ser un inconveniente y causar malestar. También, la mayoría de las proteínas son degradadas rápidamente, por la maquinaria de reciclaje de la célula y otros procesos metabólicos, eso hace muy difícil entregar la cantidad requerida para tener efecto terapéutico. Hay problemas similares con la entrega de ARN , las “copias de trabajo” de las instrucciones genéticas que indican a las células cómo construir proteínas por sí mismos.

Un reto adicional viene por la gran cantidad de diferentes terapias de proteínas (o ARN), basados en cada uno de los daños, su eliminación o la reparación, que son requeridos para mantener el vigor juvenil sano. Si cada una de estas muchas terapias basadas en proteínas tuvieran que ser entregado via inyección periódica, esto podría implicar una ida frecuente a la clínica de rejuvenecimiento para el programa completo de las sesiones de regeneración de una persona.

Aún más desafiante, es el gran tamaño de las proteínas hace difícil conseguir terapias basadas en proteínas y llevarlas a los tejidos donde se necesitan para reparar y rejuvenecer las estructuras celulares y moleculares locales. El más importante de estos casos es el cerebro.

Como alternativa a la entrega de proteínas terapéuticas (o ARN) a través de pastillas o inyecciones, muchas biotecnologías de rejuvenecimiento pueden producirse directamente en los propios tejidos donde son necesitadas. Hay dos formas principales de hacerlo: el transplante de células y tejidos diseñados con la capacidad de producir las proteínas necesarias en ellos y la terapía génica sómatica, para diseñar la capacidad en nuestros tejidos existentes.

Terapia génica de la línea germinal – algunas consideraciones

Por último, unas palabras sobre la llamada terapia génica de “línea germinal” – es decir, cambiar el genoma en el espermatozoide u óvulo, o de un óvulo fecundado, por lo que la gente ya nace con un gen terapéutico en sus células. 

Algunas personas piensan que esto siempre sería demasiado peligroso para ser útil, mientras que otros han argumentado persuasivamente que estos peligros se pueden superar. Fundación SENS no se pronuncia sobre este tema, debido a que la respuesta no es realmente importante para nuestra misión.

Cualquier terapias para prevenir o revertir la enfermedad relacionada con la edad y la discapacidad que necesite ser diseñada antes de nacer,  no sería de ninguna utilidad para aquellos de nosotros que hoy vivimos, debido al tiempo que es necesario transcurra.

Para las generaciones venideras, las terapias de la línea germinal ofrecen menos beneficios de lo que cabría pensar al principio. Esto se debe a que, mientras que el daño celular y molecular que eventualmente conduce envejecimiento degenerativo comienza a ocurrir mientras estamos todavía en el útero, y se necesitan muchas décadas para que el monto de dichos daños sea tan extenso como para perjudicar nuestra salud.

Parece que no habría ventajas de tener las biotecnologías rejuvenecimiento  presentes y activos en nuestros tejidos en el nacimiento, o incluso hasta nuestros veinte o treinta años: la cantidad de daño en los tejidos aún es inofensivo, como se desprende de la salud y el vigor de personas en estos grupos de edad.

El objetivo nuestro no es prevenir todo el daño del envejecimiento que se produzca, sino evitar que este daño alcance el umbral en el que comienza a hacernos daño, algo que comienza a los cuarenta o más años.

Gen de levadura devuelve juventud a las células

3 julio, 2011

Ud. habrá observado que los niños tienen la misma esperanza de vida al nacer, sin importar si sus padres tienen 18 ó 40 años. Esto debe significar que las células reproductivas del hombre y de la mujer, mientras menstrua, de alguna manera reajustan sus relojes. Ahora, se halló un gen que revierte los efectos del envejecimiento en la levadura y este puede proporcionarnos algunas pistas, de como sucede esto.

————————————-

Foto

Las células humanas sólo se pueden dividir un determinado número de veces. Más allá de cierto límite simplemente mueren. Sin embargo, este límite no se da en las células reproductivas, que pueden dividirse sin límite tanto en un joven de 20 años como en un hombre de 80. Se desconoce cómo se da este mecanismo de inmortalidad en las células humanas, pero un grupo de investigadores del MIT ha dado con un gen que parece controlar este proceso en las levaduras. Activando este gen pueden doblar su habitual esperanza de vida.

————————————-

Bajo condiciones de estrés, las células de levadura renuncian a la reproducción asexual y se dividen en cuatro esporas, cada una con la mitad de los cromosomas de una célula típica, como los huevos y el esperma humano. Como las células crecen, adquieren montones de proteínas y piezas extra de ADN, pero cuando Angelika Amon en el Instituto de Tecnología de Massachusetts y colegas le dieron seguimiento, las esporas a partir de células de levadura viejas y jóvenes, se encontraron con que estas anomalías desaparecieron, es decir todas las esporas tenían la misma esperanza de vida.

————————————

Durante la esporalización, un gen llamado NDT80 se expresó. El cambio en NDT80 en las células duplica su vida útil (Ciencia, DOI: 10.1126/science.1204349). El pariente más cercano de NDT80 en los mamíferos es p53, Un gen que regula los ciclos celulares. “Puede que hayamos encontrado una manera de rejuvenecer las células y marcadores de borrado en el envejecimiento”, dice Amon.

—————————————

El documento es “provocador”, dice Michal Jazwinski la Universidad de Tulane en Nueva Orleans, Louisiana: “La gente ha tratado de examinar lo que rejuvenece los gametos durante algún tiempo y como se ve, el NDT80 está jugando un papel importante. El P53 fue un gene que, en experimentos de Teresa Blasco, se le aplicó al raton triple, que se le hizo alargar sus telomeros activando la telomerasa y se inyecto un gen extra de P53 para evitar que desarrollara cancer.

En este experimento, los científicos españoles crearon una cepa de superratones transgénicos con un 45% más de vida media, al manipular un puñado de genes concretos. Es como si los humanos viviéramos un promedio de 125 años. El secreto de esos roedores estaba en la activación de tres de las estrellas en el campo de la investigación oncológica: la enzima telomerasa y los genes p53 y p16. El gen p53 es clave de la longevidad de los ratones del instituto español y es el gen responsable del control de calidad de las células. El gen p16, es otro supresor tumoral. “Al activar p53 y p16 en los ratones, la incidencia de cáncer disminuye prácticamente a cero”

referencia web: http://www.newscientist.com/article/mg21128194.800-yeast-gene-makes-old-cells-young-again.html

————————————–

En un estudio, que apareció en la edición en línea de la revista Biology Letters, se muestra que una abeja hembra puede llegar a ser ya sea una obrera o una reina. Las abejas reina son más grandes y viven más que los trabajadores, son más fértiles, mientras que los trabajadores son esencialmente estériles.

Lo increíble es que estos dos tipos de abejas hembras emergen del mismo genoma. “Entonces, ¿cómo se explica este destino?. Las primeras aproximaciones sobre el destino de las larvas se habían obtenido básicamente cambiando la dieta, es decir la cantidad y composición de los alimentos que reciben las larvas puede determinar si son obreras o reinas. Al cambiarle la dieta, vuelve a su destino común.

————————————

Cromosomes1

La gente ha sabido esto durante muchos años, pero exactamente lo que sucede dentro de las células para crear esta división no es del todo clara. Los investigadores encontraron que la vía de señalización de la insulina juega un papel en el desarrollo de las castas. La insulina es una hormona que se encuentra en los seres humanos y muchos otros animales, y los péptidos similares a la insulina se han descubierto en las abejas. La insulina transporta la glucosa (azúcar) del torrente sanguíneo a las células del cuerpo donde pueda ser utilizado.

Los investigadores eliminaron una de las proteínas claves en esta vía en las larvas de la abeja melífera. La proteína, llamada sustrato del receptor de insulina (IRS), y que se ha relacionado con el crecimiento, el desarrollo y la reproducción en ratones. Los investigadores alimentaron a las larvas alrerandoles la dieta de una reina, pero se convirtió en obreras y no en reinas.

IRS es sólo un componente del proceso que decide el destino final de una abeja. Wolschin dice varias otras moléculas son conocidas por desempeñar un papel, incluyendo metiltransferasa del ADN, la hormona juvenil y una proteína llamada TOR. “Esos son todos muy importantes y los mecanismos fundamentales”, dice Wolschin. “Una sola parte no solo puede ser responsable. Tiene que ser la interacción entre los diferentes mecanismos que finalmente da lugar a la divergencia de las reinas y los trabajadores.”

————————————–

Mientras que el medio ambiente y los antecedentes familiares son factores para un envejecimiento saludable, las variantes genéticas desempeñan también un papel importante en el complejo fenómeno de la longevidad. Según un nuevo estudio realizado por un equipo de investigadores de las Escuelas de Salud Pública y Medicina de la Universidad de Boston y del Centro Médico de Boston. En un estudio publicado por la revista Science, el equipo de investigación identificó un grupo de variantes genéticas que pueden predecir la longevidad excepcional en el ser humano con una precisión de un 77 % , esto es todo un avance en la comprensión del papel de los genes en la determinación de su ciclo vital.

—————————————

Sobre la base de la hipótesis de que excepcionalmente las personas más longevas son portadores de múltiples variantes genéticas que influyen en su supervivencia notable, el equipo realizó un estudio de asociación del genoma completo de centenarios. Los centenarios son un modelo de envejecimiento saludable, donde la aparición de la discapacidad en general se retrasa hasta que están bien en sus mediados de los noventa. Un modelo genético único que incluye 150 variantes genéticas, conocidas como polimorfismos de nucleótido único (SNPs). Encontraron que estas 150 variantes se podrían usar para predecir si una persona sobrevivirá a más de 95 años, con un alto índice de precisión.

————————————–

Una nueva investigación, desarrollada hace poco halló que la gente que hace ejercicio tiene células que, a nivel molecular, tienen un aspecto más joven que las de los sedentarios. Este estudio, del que participaron más de 2.400 mellizos británicos, descubrió por primera vez que la actividad física parece demorar la declinación de las puntas protectoras de los grupos de genes, es decir, de los telomeros. Quienes hacían una cantidad de ejercicio moderada (100 minutos semanales de tenis, natación o aerobismo) tenían telómeros similares a los de individuos cinco o seis años más jóvenes.

————————————-

Tambien se ha lograda ultimamente saber, que un equipo de científicos identificó un grupo de genes que permiten conocer el verdadero estado de “envejecimiento” de los riñones, el corazón o los músculos. Este hallazgo podrá ser aplicado para encontrar órganos saludables con miras a un trasplante, o para advertir acerca de una enfermedad inminente. Incluso el ritmo de envejecimiento de un brazo puede ser diferente al otro. En un artículo publicado en PLoS Genetics señalan haber hallado un conjunto de genes cuya actividad revela el buen o mal funcionamiento de los órganos, al margen de la edad de su dueño, descubriendo que el perfil genético es mejor indicador del buen estado físico que la edad de la persona.

————————————

Se puede decir que una nutrición adecuada y una vida armoniosa como las claves de la prevención de enfermedades y la longevidad. Por vida armoniosa debemos entender buen sexo, poco estres y buena condición física. La buena nutrición cuenta , ya que nuestros genes sólo cuenta en un 25 % y nuestros hábitos de vida un 75 %, mas o menos (dieta, gimnasia, forma de vivir).

————————————

Las predicciones de Aubrey de Grey, Gerontólogo de 48 años y jefe científico de una fundación dedicada a la investigación de la longevidadconsidera que dentro de su propio período de vida, los médicos podrían contar con todas las herramientas que necesitan para “curar” el envejecimiento. “Diría que tenemos una posibilidad 50/50 de llevar el envejecimiento a lo que yo llamaría un nivel decisivo de control médico dentro de los próximos 25 años aproximadamente”, señaló de Grey en la academia de ciencia de la Royal Institution británica.

“Y a lo que me refiero con decisivo es a la misma clase de control médico que tenemos actualmente sobre muchas enfermedades infecciosas”, añadió. De Grey cree que llegará un momento en que las personas irán al médico para un “mantenimiento” regular, el cual incluirá terapias genéticas, tratamientos con células madre, estimulación inmunológica y una serie de otras técnicas médicas para mantenerse en buena forma.

————————————-

Las ideas de Grey parecerían muy lejanas, pero ningún biólogo molecularobtuvo los 20.000 dólares que ofreció la revista Technology Review, del Instituto de Tecnología de Massachusetts, como recompensa a quien demostrara que la teoría del jefe de SENS era “tan equivocada que no merecía debate”. De Grey divide el daño causado por el envejecimiento en 7 categorías principales, para las que deben desarrollarse técnicas de reparación, mientras que en algunas categorías estamos en sus etapas más iniciales, hay otras donde ya casi ha llegado a la meta.

————————————–

“La terapia con células madre es una gran parte de esto. Está diseñada para revertir un tipo de daño, que es la pérdida de células cuando mueren y no son reemplazadas automáticamente, y ya está en ensayos clínicos (con seres humanos)”, explicó. Las cardiopatías que causan insuficiencia cardíaca, infartos y accidentes cerebrovasculares se producen por la acumulación de basura molecular. De Grey está trabajando con colegas de EE.UU. para identificar enzimas en otras especies que pueden eliminar la basura y limpiar sus células, y el objetivo posterior es desarrollar terapias genéticas para brindar esa capacidad a los seres humanos.

¿ Qué hacer con el envejecimiento hoy ?

17 abril, 2011

Desde los años ochenta que se descubrió, se han depositado grandes esperanzas en la activación de la telomerasa como método de retrasar el envejecimiento celular. Cada vez que la célula se divide, los extremos de los cromosomas o telómeros se acortan hasta que la célula no se divide más y muere. Perder telómeros es iniciar una autodestrucción de la célula.

——————————–

Cuando se altera genéticamente a los ratones para que no tengan telomeresa, los telómeros se acortan en cada generación celular y los ratones envejecen más rápido, son casi estériles y padecen osteoporosis, diabetes y enfermedades neurodegerativas. Finalmente mueren a corta edad.

——————————–

El equipo de DePinho creo ratones transgénicos que producían una versión desactivada de la telomerada. Se dejó a los ratones crecer hasta llegar a adultos sin la enzima, hasta que al cabo de un mes reactivaban la enzima. Se observaron cambios increibles al activar la telomerasa: ganaron fertilidad y sus órganos se recuperaron, sus cerebros crecieron y aparecieron nuevas células nerviosas, recuperaron el sentido del olfato, vivian más que los ratones no tratados pero igual que los ratones normales, y no aumentaron su tasa de canceres.

———————————

Por otro lado un equipo de investigadores ha logrado hacer que nematodos C. elegans, un gusano, vivan más tiempo al activar el proceso de extensión de vida de estos animales y han encontrado su relación con el proceso metabólico. Los nematodos mutantes consiguen alargar su vida con cambios en cómo las células extraen energía. La investigación muestra que los secretos de vivir mas estarían relacionados en cómo extraemos energía de la comida. Desde hace tiempo se ha comprobado que en modelos animales una dieta de restricción calórica lleva aparejado un alargamiento de la vida.

———————————-

hasta hoy, abril del 2011, existen 3 acciones que se pueden llevar a cabo con miras a influir sobre nuestro envejecimiento:

a) activar la telomerasa via AT-65 (ampliar: http://www.tasciences.com/ta-65/). Solo podemos decir que AT-65  esta en uso desde el año 2005 y sin eventos adversos.

b) aumentar la ingesta de ácidos grasos omega 3, algo que ralentiza el ritmo al que se acortan los telómeros (vea la ampliación en la web citada abajo, respecto a esto)

c) El ejercicio regular a nivel celular tiene un efecto sobre la actividad de la telomerasa y alarga los telomeros, según acaba de informar a la investigación en la revista Circulation. Ya se han creado ratones que via telomerasa viven un 40% mas (unos 120 años humanos)

——————————-

Elizabeth Blackburn está poniendo en marcha una prueba genética para medir el largo de los telomeros. Comprobar la longitud de los telómerosda da una idea de su estado de salud subyacente. Vemos acortamiento en las enfermedades del envejecimiento (enfermedad cardiaca, cáncer).

———————————-

Las personas pueden evitar el acortamiento de telomeros al cambiar su estilo de vida: los estudios muestran que el ejercicio, suplementos nutricionales y reducir el estrés psicológico puede ayudar. La gente podrá hacerse esta prueba a través de su médico, ya que saldrá a la venta a finales de año 2011, con un costo de menos de 200 dolares. Es como una prueba de colesterol. Podemos realizar una medición de muestras de sangre, hisopos de la mejilla o la saliva y se mide la longitud de los telómeros en las células blancas de la sangre.

NOTA: Para ampliar la información puede ir a: http://ariadna.elmundo.es/buscador/archivo.html?q=alargar%20telomeros&t=1&s=1) ó bien a las direcciones de abajo que estan x separado.

Telómeros: el tamaño sí importa: http://www.elmundo.es/elmundosalud/2010/02/17/investigacion/1266411483.html

Los omega 3 frenan el envejecimiento celular: http://www.elmundo.es/elmundosalud/2010/01/20/nutricion/1264000419.html

Científicos españoles crean ratones un 40% más longevos y resistentes al cáncer: http://www.elmundo.es/elmundosalud/2008/11/13/biociencia/1226579241.html

La vida sana mantiene jóvenes las células: http://www.elmundo.es/elmundosalud/2008/09/15/oncologia/1221495974.html

Test de longitud de teloméros: http://www.newscientist.com/article/mg21028100.200-telomere-nobelist-selling-a-biological-age-test.html

A %d blogueros les gusta esto: