Posts Tagged ‘ADN’

El marcador epigénetico y el cáncer

18 febrero, 2016

OTRA VEZ LA EDAD BIOLÓGICA Y LA CRONOLÓGICA EN EL TAPETE
————————————————————————–
Comienzan a aparecer los primeros métodos cientificos para aprovechar los conocimiento que brindan los genes sobre las enfermedades. La edad epigenética es una nueva manera de medir su edad biológica. Cuando su edad (epigenética) biológica es más viejo que su edad cronológica, usted está en mayor riesgo de padecer y morir de cáncer, informa un nuevo estudio. Y cuanto mayor sea la diferencia entre las dos edades, mayor será el riesgo de morir de cáncer. “Esto podría convertirse en una nueva señal de advertencia temprana del cáncer. La discrepancia entre las dos edades parece ser una herramienta prometedora que podría ser usada para desarrollar una prueba de sangre de detección precoz de cáncer.
————–
Las personas que están sanas tienen una muy pequeña diferencia entre su epigenética/edad biológica y la edad cronológica. Las personas que desarrollan cáncer tienen una gran diferencia y las personas que mueren de cáncer tienen una diferencia aún mayor. Nuestra evidencia mostró una tendencia clara, epigenética de la edad de una persona, la que se calcula en base a un algoritmo que mide 71 marcadores de metilación del ADN en la sangre que pueden ser modificados por hábitos de una persona (la obesidad, el ejercicio y la dieta) e incluye también los productos químicos del medio ambiente.
—————-
Esta prueba no está disponible aún comercialmente, pero está siendo estudiado por los investigadores académicos. En la metilación del ADN, un grupo de moléculas se une a un gen y hace que ese gen sea más o menos receptivos a señales bioquímicas del cuerpo. El gen en sí mismo -su código de ADN- no cambia. Este es el primer estudio para vincular la discrepancia entre la edad y la edad cronológica epigenética tanto con el desarrollo del cáncer, como el desarrollo de mortalidad por cáncer, usando múltiples muestras de sangre recogidas en el tiempo. Las múltiples muestras son las que muestran los cambios epigenéticos producidos con la edad, y se admiten para las mediciones más precisas de la edad epigenética . Otros estudios han analizado muestras de sangre recogidas sólo en un solo punto de tiempo.
—————
El estudio fue hecho con un diseño longitudinal con múltiples muestras de sangre tomadas entre 1999 y 2013. Los científicos usaron 834 muestras de sangre de 442 participantes que estaban libres de cáncer en el momento de la extracción de sangre. Por cada aumento de un año en la discrepancia entre la edad cronológica y epigenética, hubo un 6 % más de riesgo de contraer cáncer de un plazo de 3 años y un aumento en el riesgo de muerte por cáncer del 17 % en 5 años. Los que van a desarrollar cáncer tienen una edad epigenética de unos seis meses mayor que su edad cronológica y los que morirán por cáncer son alrededor de 2,2 años mayor, según el estudio.
—————-

La medición de cambios en los patrones de metilación del ADN está convirtiendo en un prometedor biomarcador de envejecimiento . El estudio vinculado a continuación proporciona confirmando pruebas que demuestran que este enfoque funciona para una amplia gama de edades en los seres humanos, pero aún así se puede discernir lo largo de un rango de edad bastante estrecho, incluso a edades más tempranas, aquellas en las que la gente tiende a empezar primero con futuro tratamientos de rejuvenecimiento. La metilación del ADN es una forma de epigenética marcador que altera la producción de proteínas: decoraciones unidos a ADN que cambian constantemente en respuesta a las circunstancias. Algunas de estas circunstancias implican la acumulación de daños en las células y el tejido que causa el envejecimiento , procesos que son los mismos en cada individuo, y por lo que debemos esperar encontrar cambios característicos en los patrones de metilación del ADN que reflejan el estado de envejecimiento.

See on Scoop.itNovedades Cientificas y Médicas

Terapia Génica antienvejecimiento

21 octubre, 2015

USANDO TERAPIA GÉNICA CONTRA EL ENVEJECIMIENTO
——————————————————————————-
En mamíferos, reducir la miostatina o aumentar la folistatina (que inhibe la producción de miostatina) se puede hace de varias formas, entre ellas con la terapia génica para la interferencia de ARN. Esto lleva a un aumento del crecimiento muscular, menor cantidad de grasa corporal y en ratones, al menos, una posible pero modesta extensión de la vida. La forma más directa es apagar el gen de la miostatina y es el camino elegido por investigadores chinos en trabajos con perros, usando CRISPR-Cas9, que es una forma de edición genética que es particularmente barata y precisa.
———-
Hay por lo menos una raza de perros en el que se ha producido una mutación natural del gene de la miostatina, e igual pasó con vacas, ratones (se llamaron ratones schwarzenegger), cerdos e incluso humanos, actualmente vivos y musculosos, como sus compañeros animales. La idea detrás es que la producción muscular mejorada es una terapia viable para para evitar problemas musculares conocidos y la sarcopenia, que es la pérdida progresiva de masa muscular y fuerza que se produce con el envejecimiento. Liz Parrish uso la folistatina o FS344 para actuar sobre la miostatina, lo que aumenta la masa y la fuerza muscular. Esto ha sido probado en pacientes con distrofía muscular.
———-
Es interesante contar que la empresa Bioviva, cuyo CEO es una mujer de 45 años, Liz Parrish, quién el 15 de septiembre, públicamente reconoció haber realizado una terapia génica de follistatina sobre ella misma, junto con otra alteración para evitar el acortamiento de telómeros: actuando sobre el gen mTERT, el cual en ratones de 1 año les alargó la vida un 24 % y en ratones de 2 años fue del 13 %. Lo hizo para adelantar los ensayos clínicos con humanos y los tratamientos dirigidos a frenar o revertir los efectos del envejecimiento. Como actuar sobre los genes esta prohibido en EE.UU. por la FDA, ella viajó a Colombia para hacerlo.
———-

See on Scoop.itNovedades Cientificas y Médicas

Como usar los datos en medicina

6 septiembre, 2015

El Aprendizaje automático y la ciencia de Datos van a Hacer Más pára Mejorar la Salud de TODAS LAS CIENCIAS BIOLÓGICAS Combinadas.

Sourced through Scoop.it from: singularityhub.com

LA IMPORTANCIA DE USAR DATOS EN MEDICINA ¿Cuál es la gran idea?

—————————————————–
Su genoma consta de aproximadamente 3.2 mil millones de pares de bases (el ADN) que codifican literalmente tu yo, es decir, toda tu persona. Su código de genes determina las enfermedades que podría tener, si es bueno en matemáticas o con la música, como será su memoria y cuan buena es, cómo te ves fisicamente, como te sientes, cuánto tiempo es probable que vivas y muchos más datos. Esto significa que si podemos descifrar este código genómico podemos predecir su futuro biológico y trabajar para anticipar y mejorar su salud.
—————
Es un problema de datos – y si usted es un científico de datos o experto de aprendizaje de máquinas- esto será el problema más interesante e importante que podría tratar de solucionar. En términos más simples, secuenciar un genoma significa convertir el ADN en una serie de cuatro letras que se parece a esto:
ACAAGATGCCATTGTCCCCCGGCCTCCTGCTG
Y ese genoma es un archivo de texto de unos 300 gigabytes.
————–
Al comparar su genoma secuenciado con millones de genomas de otras personas y el conjuntos de datos de los servicios de salud, podemos usar la máquina de aprendizaje y técnicas de minería de datos, para correlacionar ciertos rasgos (color de los ojos, lo que su cara parece) o enfermedades (Alzheimer, Huntington, etc.) a ciertos factores en los datos y comenzar a desarrollar diagnósticos/terapias personalizadas. Manipular los datos biológicos es como un problema de traducción, como el Google Translate. La base de datos biológicos es HLI, y todo el mundo entra en ella. Los conjuntos de datos creados incluyen lo siguiente:

Genómica: Los 3.2 mil millones de nucleótidos de madre igual de su padre.
Microbioma: El genoma de los 100 billones + microorganismos de nuestro cuerpo.
La MRI/Imagenología: imágenes detalladas del cerebro, los órganos y el cuerpo.
Metabolome: Los 2.300 moléculas en el torrente sanguíneo.
Datos de Salud Fisiológica: Todos los datos de nosotros mismos: signos vitales, niveles de glucosa en sangre, los micro ARN en la circulación sanguínea, la frecuencia cardíaca, VO2 …
Si traducimos todos estos datos obtendremos un resulado de tu salud. Similar a cómo Google Translate actúa.
—————-
El Traductor de Google (GT) usa un proceso llamado traducción automática estadística, lo que significa que GT genera traducciones basadas en patrones que se encuentran en grandes cantidades de texto escrito. En vez de enseñar a la computadora todas las reglas de todos los idiomas, este enfoque permite que ella descubra las normas por sí misma en base a los patrones estadísticos significativos en los datos. Una vez que halla estos patrones, puede usar este “modelo” para traducir el texto similar en el futuro. Asi traduce en 90 idiomas diferentes. El reto ahora es usar lo mismo con la Genética, los registros de salud, y nos encontramos a la persona perfecta para liderar este esfuerzo: Franz Och – el hombre responsable de la construcción de Google Translate. “La gran misión es aprender a interpretar el genoma humano y ser capaces de predecir cualquier cosa que nos pasa a partir del código fuente”.
—————-
HLI está buscando ahora mismo lo siguiente: fuertes ingenieros de software que pueden construir de alta calidad, software fiable y de alto rendimiento, Expertos de aprendizaje automático y Estadísticas expertos. Aqui puede aplicar: http://www.humanlongevity.com/careers/open-positions/

ñada su visión …

See on Scoop.itNovedades Cientificas y Médicas

Bacterias c/Nanoparticulas = Vacuna anticáncer ya esta

17 abril, 2015

Marking an important step in the development of immunotherapy cancer treatment, scientists have demonstrated that nanoparticle-coated bacteria can effectively deliver an oral DNA vaccine that stimulates the body’s own immune system to destroy its cancer cells. This is the first time that a nanoparticle …

Source: medicalxpress.com

VACUNA anticáncer CON EL SISTEMA INMUNE ES UN HECHO
—————–
Una vacuna de ADN oral que los investigadores han estado trabajando se llama NP/SAL, que suprime la angiogénesis tumoral (formación de vasos sanguíneos), sin los cuales los tumores no pueden prosperar. Muchos tumores secretan factores angiogénicos como el factor de crecimiento endotelial vascular (VEGF) para promover la formación de vasos sanguíneos, que eventualmente conducen a la metástasis tumoral. La vacuna NP/SAL estimula el sistema inmune para producir células T (células blancas de la sangre) y citoquinas (mensajeros químicos), que interfieren con la vía VEGF, reduciendo la formación de vasos de sangre y en última instancia inhibiendo el crecimiento tumoral.
————
Aunque esta estrategia es efectiva si se logra una respuesta inmune fuerte, ese reto esta en poner la vacuna en el lugar adecuado, que es el INTESTINO INFERIOR, desde ahí donde se difunde a la sangre. Para hacer esto insertamos la vacuna en el ADN de bacterias vivas, tales como la Salmonella (atenuada su toxicidad a niveles seguros) y cuando se administra la vacuna (realizado por las bacterias) las bacterias invaden el cuerpo como en una infección bacteriana típica, colonizando, reproduciendo y difundiendo su ADN y la vacuna con él. Antes de la vacuna logre activar el sistema inmune deseado, debe superar 2 obstáculos:
a) Eludir a los macrofagos: las bacterias encuentran una respuesta inmune común en la que los glóbulos blancos (llamados macrófagos) las fagocitan y atrapan dentro de vesículas llamadas fagosomas. Pocas bacterias escapan a los fagosomas,
b) las que lo logran han de encontrarse con el ambiente altamente ácido del estómago y los intestinos. Sólo un pequeña parte de las bacterias originales van más allá de estos dos obstáculos, que son las principales razones para el fracaso de la vacuna hasta la fecha.
————–
Pero en este nuevo intento, las bacterias estan recubiertas con nanopartículas  y por ello tienen muchas más posibilidades que las bacterias no recubiertas de superar los dos obstáculos y llamar al sistema inmune. Las nanopartículas contienen polímeros cargados positivamente, que se auto-ensamblan en las paredes celulares cargadas negativamente de la Salmonella debido a las interacciones electrostáticas. Las bacterias recubiertas pueden tolerar mejor el ácido del estómago y los intestinos, en parte porque el recubrimiento actúa como un amortiguador, que resisten cambios en el pH, y en parte debido a la protección física que ofrece. El revestimiento también ayuda a la bacteria a escapar los fagosomas porque los polímeros catiónicos inician un “efecto esponja de protones”, absorbiendo los protones y causando que los fagosomas se hinchen y rompan la ósmosis. Por estas ventajas, las bacterias recubiertas con nanopartículas pueden llegar. El 60% de los Ratones vacunados con NP/SAL sobrevivieron los 35 días del estudio sin crecimiento del tumor y casi sin perder peso, lo que indica poca toxicidad.
————-
Los investigadores esperan que esta estrategia de usar bacterias recubiertas con nano-partículas como vectores de vacuna de ADN se pueda aplicar a muchas vacunas y usarse en muchos tipos de cánceres y enfermedades inmunológicas. Esto fue posible porque empezamos a entender cómo las células cancerosas escapan al reconocimiento y ataque del sistema inmune. Y esto ofrece quizás la posiblidad de hacer vacunas que pueden lograr la acción inmune contra el cáncer. Porque revestimientos bacterianas se pueden lograr simplemente por el auto-ensamblaje entre las bacterias y las nanopartículas, esperamos que este tipo de vacuna se puede utilizar como medicamento tradicional en una formulacion común en pacientes en los próximos 3-5 años. Debido a que hay un buen número de opciones en bacterias además de la Salmonella y también una gran variedad de nanopartículas funcionales disponibles, esperamos lograr el optimo para aplicaciones específicas. Las propiedades adaptables y versátiles de esta estrategia de diseño de vacunas se abre nuevas posibilidades para el tratamiento de un amplio espectro de enfermedades inmunológicas en la era amanecer de la nanomedicina personalizada.
———–

See on Scoop.itNovedades Cientificas y Médicas

Sepa como Envejece

7 abril, 2015

TENGA IDEA DE COMO ENVEJECE EL SER HUMANO
————————–
Cada vez vivimos más y en mejores condiciones, pero el proceso de envejecimiento comienza mucho antes de lo que imaginamos. La mayoría de los cambios vienen por el sedentarismo y mala alimentación. Otros son debido al desgaste celular que no reponemos. Un mejor conocimiento del envejecer, implica verlo como un proceso, para poder entender el radio de acción que tenemos hoy para llevar a cabo una vida con mayor calidad. El ritmo, los momentos y el como dependen de cada persona, de lo que ella haga día a día, de lo que sus padres y abuelos hicieron también durante su vida (herencia genética y epigenética).
———–
En general, podemos afirmar sin equivocarnos que las personas no son conscientes más que de los cambios más obvios (no pueden leer o van al baño muchas veces, etc.) pues en general, la persona media no sabe ni siquiera cuantas veces late su corazón por minuto, debido a que han sido criados y educados desconociendo toda esta información importante (ritmo cardiaco, colesterol, presión sanguinea, etc.) e incluso, en muchas culturas muy machistas, era un sintoma de debilidad o poca masculinidad el mostrar interés por estos temas. Hoy, tenemos otra visión sobre estos temas e incluso otra tecnología que nos ayuda: aparatos baratos y fieles que miden esos datos y en la comodidad de nuestras casas.
————-
He aqui un resumen de los cambios que se van produciendo con los años.

A LOS 18: 

– PIEL: LA PRODUCCIÓN DE COLÁGENO Y ELASTINA BAJA UN 1% AL AÑO: desde esta edad. La piel se vuelve más fina, pierde elasticidad, se seca más y se rasga con más facilidad. La persona no nota nada al principio, pues nuestra vista no es de lo mejor.

A LOS 20 AÑOS:
– CEREBRO: LA CANTIDAD DE NEURONAS COMIENZA A DESCENDER: Nacemos con más de 100.000 millones de neuronas, número que comienza a reducirse a los 20 años.

A LOS 25:
– PULMONES: DISMINUYE NUESTRA CAPACIDAD AERÓBICA a un ritmo de 10% cada diez años, o aún mayor, dependiendo de cuanto sedentarismo practiquemos.

A LOS 30:

– PIEL: LLEGAN LAS PRIMERAS ARRUGAS Especialmente en la zona de los ojos.
– RIÑONES: EMPIEZAN A FILTRAR PEOR LA SANGRE. Desciende el número de células, secretan demasiada agua y muy poca orina.
– HORMONAS: DESCIENDE GRADUAL LA PRODUCCIÓN DE TESTOSTERONA a un ritmo del 1% anual y esta hormona afecta muchas cosas, incluso hasta la personalidad.
– PULMONES: PIERDEN CAPACIDAD DEL 1% AL AÑO A PARTIR DE LOS 30. Se debilitan los músculos, desciende el número de alvéolos y obtenemos menos oxígeno del aire respirado. Son las primeras muestras del sedentarismo y sus efectos físicos.
– MUSCULATURA: COMIENZA A DISMINUIR LA MASA (Y FUERZA) MUSCULAR la que se reducirá más de un 10 al 25% en toda nuestra vida adulta. Otra consecuencia variable con nuestro nivel de sedentarismo.

A LOS 35: 

– EMPEZAMOS A PERDER CAPACIDAD AUDITIVA y a poner mayor volumen a radios, TV y al hablar más fuerte.
– LOS HUESOS EMPIEZAN A PERDER MASA ÓSEA a un ritmo del 1% al año. También influye el sentarismo.
– DESCIENDE LA FERTILIDAD. Baja el número y la calidad de óvulos y del esperma.

A LOS 40:

– CEREBRO: Pierde unas 10.000 NEURONAS al día lo que afecta a la memoria, coordinación y funciones superiores.
– ENCÍAS: retrocede levemente y los dientes se exponen más a restos de alimentos, también se desgasta el esmalte.
– EMPEZAMOS A PERDER ESTATURA (1 cm cada década). Los discos que separan las vértebras se estrechan, podemos llegar a perder entre 2,5 y 7,5 cm de estatura.
– VISTA: DE CERCA DISMINUYE pues la lente se vuelve más rígida, y cuesta enfocar objetos a menos de 60 cm.
– PIEL: ARRUGAS MÁS MARCADAS (LABIO SUPERIOR). La capa de grasa es más delgada, favorece la formación de arrugas y nos hace más sensibles al frío.
– CORAZÓN: MENOS Y MAYORES CÉLULAS MUSCULARES DEL CORAZÓN. El corazón tarda más en llenarse, las arterias se vuelven más rígidas y aumenta la tensión arterial.

-METABOLISMO: COMIENZO DE LOS PROBLEMAS DIGESTIVOS provocados por la mala dieta.

 A LOS 50: 

– OIDO: NOS CUESTA ESCUCHAR TONOS AGUDOS. Más difícil distinguir palabras.
– SENTIDOS: Disminuye el olfato y el gusto lo que afecta más a sabores salados y dulces que a los amargos o agrios. Esto puede aumentar el consumo de alimentos no saludables con exceso de sal o azucar.
– MENOS NEFRONAS, los riñones pierden capacidad de filtrado.
– METABOLISMO: Aumenta el nivel de azúcar en sangre, en ayunas: entre 6 y 14 mg/dL cada década.
– AUMENTA EL TAMAÑO DE LA PRÓSTATA, pasandose de ser una nuez/avellana al tamaño de una mandarina.
– VISTA: Ojos más secos. Podemos ver “moscas” por la solidificación de los fluidos.
– PIEL: Continua su decadencia y las arrugas son ahora más profundas. Aparecen las manchas de la edad, pues hay peor gestión del calor y cicatrización más lenta en la piel.
– EDAD MEDIA DE COMIENZO DE LA MENOPAUSIA: Se contraen ovario y útero, los tejidos de la vagina son menos elásticos y más secos.
– PÉRDIDA MÁS ACELERADA DE DENSIDAD ÓSEA POR LA MENOPAUSIA. Sobre todo en la cabeza del fémur, en las muñecas y las vértebras.

– PROBLEMAS DE ULCERAS, ACIDEZ, HERNIAS ESTOMACALES, ETC. debido a la mala dieta se pueden ver en un 50 % de hombres y mujeres.

 A LOS 55: 

– DEL 10 AL 25% DE LOS HOMBRES BAJA SU NIVEL DE TESTOSTERONA, lo cual provoca menos esperma, baja la libido, menor flujo sanguíneo al pene (erecciones más cortas o menos rígidas, mayor riesgo de impotencia).
– LOS HOMBRES GANAN PESO HASTA LOS 55. A partir de esa edad comienzan a cambiar la forma fisica de piernas, pecho, brazos debido al aumento notable de la grasa y perdida muscular.

-DISMINUYE LA CAPACIDAD CEREBRAL DE ANALIZAR: debido a que la memoria, la atención y la percepción fina de los cambios se van perdiendo. Hay tendencia a sufrir ansiedad, depresión y adquirir o apuntalar adicciones con las comidas, bebidas , etc.

A LOS 60:
– DESCIENDE EL NÚMERO DE CÉLULAS EN LA MÉDULA ESPINAL. No afecta a nuestra fuerza ni a nuestra sensibilidad.
– VEMOS PEOR CON LUZ TENUE. Una persona de 60 años necesita 3 veces más luz que una persona de 20 años, la lente es más densa, deja pasar menos luz.
– LAS VELLOSIDADES INTESTINALES SE “ALISAN”. Se absorben menos nutrientes, el movimiento es más lento y es más probable sufrir estreñimiento.

-LA TEMAS DE MEMORIA Y RELACIÓN DE COSAS SIGUE PERDIENDO CALIDAD

A LOS 65:

– PÉRDIDA GRADUAL DEL OÍDO.

– MAYOR RIESGO DE EROSIÓN Y PÉRDIDA DE DIENTES.
– AUMENTA EL RIESGO DE PADECER ENFERMEDADES CARDIOVASCULARES (ictus, infartos, etc.)
– SE REDUCE LA CELULARIDAD DE LA MÉDULA. Cuando nacemos el 80-100% de la
médula ósea está compuesta por células hematopoyéticas, a los 65 años sólo el 50%.
– RIESGO DE PADECER CATARATAS.
– LA MENOPAUSIA CONTRIBUYE A LA INCONTINENCIA. La falta de estrógenos hace que se debiliten los tejidos de la uretra y ello lleva, tanto en hombres como mujeres a tener olor a orin en su ropa interior (antes llamado “olor a viejo”).
– LAS MUJERES GANAN PESO HASTA LOS 65. Y luego empiezan a perderlo, el músculo magro es reemplazado por grasa.

A LOS 70: 

– CAMBIOS EN LA PERCEPCIÓN DE LOS COLORES. La lente se amarillea, los colores pierden brillo y es más difícil ver los contrastes.
– MENOR CAPACIDAD PULMONAR. Un hombre de 70 años inhala medio litro de aire en una bocanada, la mitad que uno de 30. El efecto varía de acuerdo al sedentarismo que viva la persona.
– INCONTINENCIA URINARIA. Una persona de 70 años tiene la mitad de capacidad que una persona de 30 años. El típico olor a viejo o vieja (orin en la ropa interior) se intensifica por estos motivos si la persona no presta atención a ello.
– SE REDUCEN SUTILMENTE ALGUNAS TAREAS MENTALES. vocabulario, memoria a corto plazo y la habilidad de aprender sufren las consecuencias.
– EL HÍGADO SE HACE MÁS PEQUEÑO. Sus células, con gran capacidad de regenerarse, son cada vez menos y su trabajo pierde eficacia, los efectos de los fármacos se vuelven más duraderos.

A LOS 75:
– PÉRDIDA DE VISIÓN PERIFÉRICA. Entre los 70 y los 80 años perdemos entre 20º y 30º de visión periférica.

– LOS RIÑONES ya filtran la mitad de sangre que una persona de 30 añós.
– UN 30% DESARROLLA MÁS CARIES DE RAÍZ.
– MAYOR PROPORCIÓN DE GRASA MUSCULAR. Proporcionalmente se tiene 2 veces más grasa que al principio de la vida adulta, la que se distribuye de otra manera y cambia la forma del torso.

A LOS 80:

– DIFICULTAD PARA DISTINGUIR SOMBRAS Y PERCIBIR LA PROFUNDIDAD.
– LAS OREJAS Y LA NARIZ NUNCA DEJAN DE CRECER. Las orejas crecen a un ritmo de 0,22 mm por año lo que es mas o menos 1cm en 50 años.
– EL 50% SUFRE PÉRDIDAS DE AUDICIÓN.

———————–

Las diferencias en las esperanza de vida, si se mira bien son mínimas. ¿Cuánto más vive un japones que un Argentino?. Pongamos que 7 años en promedio, como mucho y unos 4 años más que un norteamericano. Todo muestra que hemos llegado a un techo y para superarlo, necesitamos una visión diferente del tema. Es claro que la vejez es dañina e implica cambios en el metabolismo que conducen a un deterioro progresivo del cuerpo. Pero esos daños, quizás se puedan reparar dentro de un tiempo. Con mejor mantenimiento, hoy ya podemos permanecer más tiempo saludables. Esto es facil de comprender.
—————–
Los daños basicamente se producen por las mutaciones nucleares y mitocondriales a nivel celular. La especie de basura molecular que va produciendo el metabolismo, tanto en el interior como exterior de las células son posiblemente causantes de problemas (Alzheimer, problemas inmunes, diabetes, etc.). También la pérdida de la elasticidad de las conexiones celulares también tienen su efecto. El medio ambiente en que vivimos y nuestros hábitos diarios también hacen su parte. La ciencia siempre a ido en contra de la naturaleza: el auto nos impide caminar, las vacunas nos impide enfermarnos, etc. Esa es la base de nuestro progreso científico y la que nos permite vivir vidas más largas y plenas hoy. Renegar de ello no tiene sentido, asi como cuestionarlo.
—————–
Es claro que el cerebro está hecho de la misma materia que el resto del cuerpo: esto es celulas y más celulas. Si nuestro cuerpo se mantiene mejor o logra rejuvencer, también lo hará nuestro cerebro. A las personas normales, siempre les va a resultar mucho mejor vivir entre una población activa y sana que hacerlo en sociedades envejecidas y enfermas. La vejez es una masacre, dijo alguna vez Woody Allen. Creo que tenía razón.
—————–

See on Scoop.itNovedades Cientificas y Médicas

Razón contra emoción

22 marzo, 2015

RAZÓN Vs EMOCIÓN – La envidia y la agresión ¿son necesarias?
—————-
La idea de un cerebro racional, separado de las emociones se remonta a la época de Platon (427 a.c-347 a.c.), el veía a las emociones como propias del instinto salvaje. Darwin pensaba que las emociones eran el vestigio animal en nosotros y que ahora no tiene un fin útil, como lo tuvo en su pasado. La pregunta aqui es…el no cargar con los sentimientos ¿nos hará mejores personas?.

—————–

Todas las pruebas indican que los seres humanos somos influidos por todo lo que nos rodea, seamos o no conscientes de ello. Y a su vez hay que tener en cuenta, que el cerebro es quién construye lo que vemos, es decir, lo que captan nuestros ojos. Asi crea su realidad individual cada uno de nosotros. Sin los sentimientos y emociones, no tendríamos envidia ni agresión, elementos muy útiles para que en nuestra época de primates lograramos abrirnos paso en el mundo.
—————-
¿Necesitamos hoy la envidia y la agresión para poder evolucionar?. Aparentemente es más un estorbo que una ayuda y es también la explicación de porque aún tenemos parte del mundo con hambre y en el subdesarrollo. El cerebro también tiene un mecanismo que fue útil en el pasado y que nos hacía subestimar el peligro y sobrestimar nuestras fuerzas. Debido a un mecanismo existente en el cerebro, el 80 % de la gente, no todos, tienden a subestimar los peligros en nosotros: fumar hace mal, pero no a nosotros. Andar en moto aumenta un 40 % el riesgo de muerte en accidentes de tránsito, pero a mi no me ocurrirá.

————–

En general, el cerebro niega todo lo negativo respecto a si mismo, pero no hace lo mismo con los demás. Es la visión de la brizna de paja en el ojo ajeno y no la viga en el propio. Cada uno de nosotros construimos nuestra realidad individual y también creamos nuestra realidad compartida, con el resto de la sociedad. Comunmente sufrimos la manipulación de los estimulos externos, como son los ruidos, la presencia de otros, los olores que penetran en nuestro ofato y van directamente al cerebro, sin la censura de nuestro tálamo, la publicidad con imagenes también penetra en nuestro insconciente constantemente. Pero no somos concientes de todo esto.
——————
El cerebro rinde mas cuando se encuentra relajado y bien enfocado: este estado es llamado estar en zona, por los deportistas y atletas. Significa estar con las ondas cerebrales (alfa y theta) en buen estado para el momento de la prueba. Este estado del cerebro se puede captar con celulas puestas en la cabeza, las que transmiten las ondas electricas del cerebro y pueden indicarnos el momento en que este está bien balanceado para actúar.

—————-

Se han hecho pruebas con tiros de flechas y arcos por ejemplo y se ha logrado que un amateur logre el nivel de un experto en minutos, es decir, lance la flecha y dé en el centro del blanco, solo colocando a sus ondas cerebrales, captadas por la sonda en la cabeza, en la misma posición en que dispara el campeón de tiro de arco. Es como copiar una habilidad motora usando los datos electricos del cerebro. Esto a sido llamado crackear el cerebro, tal como se hace con el software de una computadora.
——————-

See on Scoop.itNovedades Cientificas y Médicas

Cómo se forma nuestra personalidad y preferencias

18 marzo, 2015

COMO SE FORMA LA PERSONALIDAD Y PREFERENCIAS PERSONALES – 18 de marzo de 2015 a la(s) 12:21

Hoy sabemos que cuando la persona duerme, se le puede inducir una asociación entre un sonido o palabra y una sensación plancentera o de displacer y esa persona reproduce la sensación al oír el sonido o la palabra y esta sensación puede detectarse a traves de su respiración insconciente, es decir, eludiendo el posible error de su propia percepción. Se han hechos pruebas al respecto y asi funciona.

———–

Pues bien, cuando nosotros vamos creciendo, todos los seres humanos vamos también recibiendo estas señales via sonidos, palabras, imagenes, olores, paisajes, etc. y asi llegamos a nuestra juventud, donde nos encontramos que nos gusta más el asado, el color azul, la gente rubia o cualquier otra cosa, sin tener la más mínima idea de donde surgieron esas preferencias y no preferencias que manejan nuestra vida.

———-

En otras palabras, somos la simple interacción entre nuestros genes y el medio ambiente que nos rodea. Esa interacción es muy diversa y es casi imposible que nuestro pequeño cerebro pueda registrar, en forma consciente, todos estos hechos que se van sucediendo en la vida cotidiana y alterando el encendido/apagado de genes, los que determinarán si somos activos, optimistas, pesimistas, etc. Explicado esto, podemos entender entonces, como se forman nuestras preferencias, aspiraciones, adversiones, simpatias, etc. en nuestra vida. Y al entender este proceso, veremos que todos nuestros hábitos, adicciones y pre-juicios fueron armados por circunstancias no racionales, sino más bien, azarosas, a lo largo de nuestras vidas, por lo que asi visto, nuestros deseos y gustos son cuestionables, modificables, cambiables, etc.. Se llama epigenética al estudio de todo lo que enciende y apaga genes humanos.

———-

Veamos un poco más en detalle esto de la sugestión insconciente. La forma obvia que todos conocemos es la manipulación del cerebro desde el exterior, ya sea con publicidad, drogas o con juegos mentales psicológicos. Esta manipulación del cerebro la hacemos también al tomar un café, prender un cigarrillo, tomar una cerveza, un remedio, etc. Cuando hacemos esto le estamos pidiendo al cerebro que actúe en consecuencia, de alguna manera. Pero ahora ya estamos en condiciones de afirmar que, es posible manipular el cerebro, apagando/activando celulas pulsando una luz láser a través de sondas conectadas al cerebro.

———

Asi podriamos activar/desactivar zonas de celulas enfermas y curar adicciones, enfermedades mentales, etc. Si usamos los genes de algas que tienen un sensor luminico (llamados opsinas), los que sirven como proteínas foto-sensoriales, convirtiendo la luz en un cambio especifico de potencial electrico: el mismo que producen las neuronas cuando se activan en el cerebro. Insertando estos genes en un virus que pueda reproducirse a si mismo en el ADN de las neuronas vivas, estas crearán la proteína y luego se extenderan a otras células, y asi cada neurona tendrá su propio interruptor sensible a la luz de activar/desactivar.

———

Un dispositivo con un laser conectado a un conjunto de fibras ópticas, implantado en el cerebro varios de ellos en un patrón tri-dimensional, puede introducir información al cerebro suministrando luz y asi operando como interruptor, al pulsar el láser. Esto que parece increíble, pues ya se ha hecho con ratones y ha funcionado!. Se activó el ciclo recompensa/placer al igual que lo hace una comida. Para su información, un milimetro cúbico de cerebro alberga unas 100.000 neuronas y entre ellas existe unas 1.000 millones de conexiones mediante electricidad. Complejo…pero no imposible!.

———–

REF

See on Scoop.itNovedades Cientificas y Médicas

Trazan 1er. Mapa Epigenético

18 febrero, 2015

If the genome is the musical score of life, the epigenome is how the orchestra goes about playing it.

Source: www.washingtonpost.com

CARTOGRAFÍA DEL EPIGENOMA HUMANO
—————-
El epigenoma humano es lo que hace que un gen no dependa solo de su secuencia (gattacca), sino que hay otras cosas que pueden influir sobre esto (de ahí el agregado de “epi”, el que literalmente significa “encima de”), como son los grupos más sencillos de la química orgánica (metilo, CH3) y ciertas proteínas especializadas en empaquetar el ADN llamadas histonas. Esto explica que aunque todas las células tengan el mismo genoma, unas se conviertan al final en células de la piel, otras en neuronas y así hasta los más de un centenar (111) de tipos celulares especializados, o diferenciados, que constituyen el cuerpo humano.
—————–
Los investigadores han lanzado la cartografía más completa del epigenoma humano hasta la fecha, utilizando el análisis masivo de datos para entender cómo y por qué los genes se pueden apagar y encender en las células humanas. Su trabajo, publicado el miércoles en la revista Nature , podría conducir a nuevos tratamientos para una multitud de enfermedades, incluyendo el cáncer. Este macroproyecto revela hoy el mapa epigenómico humano, que localiza dónde están esas modificaciones (metilos, histonas) en todos los tipos celulares importantes del cuerpo humano y también en 58 enfermedades (genéticamente) complejas. Como pasó con el proyecto Genoma Humano, la información se hará pública y gratuita para todo el mundo.
————–
Los investigadores y el profesor del MIT Manolis Kellis analizaron un total de 150.000 millones de Secuenciaciónes del Genoma. Se uso de un algoritmo especialmente desarrollado, para ver este conjunto de datos de forma masiva y buscar cambios epigenómicos en 111 tipos de células diferentes. La tarea de secuenciación se lleva a cabo bajo un programa de investigación de 10 años del Gobierno estadounidense, el Programa de Hoja de Ruta de Epigenómica, lanzado en el 2008 con un financiamiento de 240 millones de dólares y asi se llegó a estos interruptores moleculares que pueden encender o silenciar genes individuales en el ADN en más de 100 tipos de células humanas
Las diferentes combinaciones de marcas epigenéticas caracterizan diferentes regiones del genoma, lo que refleja las funciones específicas que desempeñan en cada célula, nos dice Kellis.
————-
Al estudiar estas combinaciones sistemáticamente, podemos aprender el idioma del epigenoma y lo que nos dice de su actividad y función en cada región genómica y en cada uno de los tipos de células. En uno de los estudios publicados los investigadores ataron cambios celulares específicos a 58 rasgos biológicos diferentes. A veces los cambios epigenómicos de una célula revelan posibles pistas sobre una enfermedad. Como ejemplo, se encontraron mutaciones asociadas con el Alzheimer que cambian la actividad genómica de las células inmunes, no sólo de las células cerebrales. Esto se halló en un modelo de ratón, por lo que podría no aplicarse a nosotros, pero si lo hace, daría nuevas áreas para tener en cuenta cuando se intenta tratar la enfermedad.
————–
La numerología del proyecto escapa al ámbito de las grandes cifras: más de 100 tejidos primarios y tipos celulares, 2.800 experimentos cada uno a escala del genoma entero, 150.000 millones de sondas o fragmentos de ADN que cubren el genoma 3.000 veces. Ahora ya pueden ver que, las variantes genéticas asociadas a la diabetes de tipo 1, la artritis reumatoide y la esclerosis múltiple están activas en las células del sistema inmune. Y esto es lógico, puesto que esas tres enfermedades pertenecen a la categoría autoinmune, es decir, que están causadas por un funcionamiento anómalo o excesivo de las defensas, que se dedican atacar a las células pancreáticas, articulares o nerviosas del propio paciente. Pero la lógica no sirve para encontrar tratamientos, y lo que tenemos ahora son datos duros que sí lo permitirán.
————
En la misma línea, las variantes genéticas asociadas con la presión arterial están activas en las células del corazón, las asociadas con un alto nivel de colesterol y por ello, asociadas con una probabilidad incrementada de infarto, funcionan en el hígado, como las asociadas a los trastornos metabólicos. Todo esto tiene su lógica también. Los datos obtenidos y no la pura lógica, será lo que permitirá avanzar en el conocimiento de estas enfermedades y buscar tratamientos eficaces. En el alzhéimer, puesto que se trata de una enfermedad neuro-degenerativa (que va matando neuronas progresivamente) cabría esperar que las variantes genéticas que lo favorecen estén activas en las neuronas, causando asi la acumulación de proteínas tóxicas amiloides, pero parece que no es así. Esas variantes funcionan en las células del sistema inmune: en concreto en las células denominadas monolitos CD14. Esto cambia por completo la perspectiva para investigar tratamientos preventivos o paliativos del alzhéimer.
————–

Los científicos ahora tendrán que descifrar cómo el epigenoma afecta los genes, y también determinar cómo la vida que llevan las personas puede afectar su epigenoma. Una vida de factores ambientales y de hábitos de vida, son los que influyen en el epigenoma, como fumar, hacer ejercicio, hábitos alimenticios, exposición a químicos tóxicos e incluso la crianza. Esto es poner la salud practicamente en sus manos.

¿Qué tiene la medicina hoy para mi?

29 enero, 2015

¿QUÉ TIENE LA MEDICINA HOY PARA MI?
——————–
La medicina de hoy 2015, no la del año 2000, tiene muchas cosas positivas para usted. El gran inconveniente es que usted aún no se ha enterado de nada. Considere por unos momentos algunas cosas que usted seguramente ha subestimado:

a) los 70 mg de aspirina diaria para prevenir ataques al corazón
b) los factores de riesgo modificables, como el nivel de colesterol y la presión sanguinea
c) los riesgos manejables cardíacos, de cancer, de alzheimer, repito, riesgos manejables por usted como el tabaquismo, sedentarismo y la dieta.
d) el analisis genético que le avisa que farmacos no tomar, de que cosas debe cuidarse, de que debe hacer si quiere perder peso o mantener musculo…en fin.
Hay muchas cosas que a usted se le pasaron por alto. Como sucedió en tantas otras áreas del conocimiento.
—————–
Si quiere enterarse más sobre estos temas y sobre lo que está en sus manos y que realmente puede hacer hoy, esta en un libro hecho para mostrarselo (www.createspace.com/5034300)…sólo que usted, al igual que dije antes…AÚN NO SE ENTERÓ!.

See on Scoop.itNovedades Cientificas y Médicas

Explicando qué es la Epigenética

11 enero, 2015

EXPLICANDO LO QUE ES LA EPIGENÉTICA
——————-
Al contrario de lo que la mayoría cree, cambiar nuestra salud puede ser tan simple como cambiar sus pensamientos y creencias. El saber que nuestras creencias pueden cambiar nuestra biología, aumentar nuestra autoestima y mejorar nuestro estado emocional es lo contrario a lo que las personas estan creyendo ahora mismo.
——
Todos tenemos genes que suprimen los tumores, GENES que son capaces de detener las células de cáncer y están presentes en todas las células del cuerpo, pero también tenemos las proteínas llamadas histonas. Como lo explica el Dr. Jean-Pierre Issa del Centro del Cáncer MD Anderson5, las histonas pueden abrazar apretadamente al ADN al grado que lo ocultan de la vista de la célula. Si un gen supresor de tumor está oculto, no podrá usarse y asi, demasiada histona apagara estos supresores de cáncer y permitirá que el cáncer prolifere.
—–
Ahora aquí es donde entra en juego la epigenética. Ciertos alimentos, como el brócoli y otros vegetales como el ajo y la cebolla contienen sustancias que actúan como inhibidores de las histonas, que son las que bloquean a las histonas, y esto hace que sus genes supresores de tumores se activen y puedan luchar contra el cáncer. Al consumir regularmente estos alimentos, usted está apoyando de forma natural la capacidad de su cuerpo para combatir los tumores.
——
Asi que la buena noticia que la mayoría aún no sabe, es que tenemos el control de nuestros genes: podemos alterarlos regularmente, dependiendo de los alimentos que comamos, aire que respiramos y los pensamientos que tenemos, o si lo prefiere, el estres que manejamos. Este hallazgo está listo para hacer grandes cambios en prevención de enfermedades futuras, lo cual incluye educar a las personas sobre cómo combatir la enfermedad a nivel epigenético. Cuando se presenta una enfermedad, la solución, de acuerdo con la terapia epigenética, es simplemente recordarle a sus células afectadas (cambiar sus instrucciones del medio ambiente) su función saludable, para que puedan volver a ser células normales en lugar de células enfermas.
——–
Usted puede comenzar a hacer esto por su propia cuenta, mucho antes de que manifieste una enfermedad. Al llevar una vida sana, con una nutrición de alta calidad, ejercicio, exposición limitada a las toxinas y una actitud mental positiva, con esto animara a que genes expresen comportamientos positivos que combatirán las enfermedades. De esto es lo que se trata la medicina preventiva, lo cual es la medicina del futuro. No se trata de tomar nutrientes sin saber que parte de su maquinaria biológica especifica lo precisa. También vale la pena señalar que los efectos epigenéticos comienzan antes del nacimiento.
——–

See on Scoop.itNovedades Cientificas y Médicas

Ciencia médica siglo XXI

4 diciembre, 2014

Ciencia médica siglo XXI
—————-
Si el envejecimiento es puramente una cuestión de daños debemos esperar que todas las mejoras en la salud a largo plazo extendien también la vida, en algún grado. Si hay menos daño, entonces, es razonable esperar que la maquinaria dure más, lo que es un simple concepto, sabiendo que la maquinaria biológica es compleja. Los únicos límites de vida son impuestos en el presente, al parecer por la incapacidad que tenemos para solucionar los problemas que nos matan, pero que sabemos que pueden modificarse con la financiación e investigación correcta. No deja de ser un mensaje optimista, a futuro.
———–
Mientras tanto, el tema de células madre regenerativas sigue evolucionando. En abril de 2009, se demostró que la generación de células iPS es posible sin ninguna alteración genética de la célula adulta: un tratamiento repetido de las células con ciertas proteínas canalizados en las células a través de anclajes de poli-arginina era suficiente para inducir pluripotencia. El acrónimo dado para esas iPSCs es piPSCs (madre pluripotente inducida por la proteína célular). En noviembre de 2012 investigadores de Austria, Hong Kong y China presentaron un protocolo para generar células iPS humanas a partir de células epiteliales renales exfoliadas presentes en la orina. Este método de adquirir células del donante es menos invasivo y sencillo. Una demora de 2 semanas para el cultivo de células de orina y de 3 a 4 semanas para la reprogramación, con un rendimiento de hasta 4%.
————-
El primer ensayo clinico en humanos utilizando células autólogas iPSCs fue aprobado en Japón y se hizo en 2014 en Kobe. iPS derivadas de células de la piel serán reprogramados para diferenciarse en células del epitelio pigmentario de la retina (EPR). Los beneficios de usar iPSCs autólogas son que no hay riesgo de rechazo y elimina la necesidad de utilizar células madre embrionarias. El año pasado un artículo científico del laboratorio de Shoukhrat Mitalipov tuvo éxito en la clonación de un ser humano hasta la etapa de embrión y de ahí produce células madre de el. Este año, al menos, 3 laboratorios lo han reproducido. Esto ha sido un gran avance científico. Las células madre embrionarias (CME) pueden ser propagado casi indefinidamente en cultivo y tienen el potencial de diferenciarse en cualquiera de los tipos de células más de 200 en el cuerpo de un adulto. Los CES clonados también pueden llevar a anomalías y su material genético no es 100% idéntico al ADN clonado -el ADN mitocondrial pertenece al donante del ovocito. Habra que ver cuales serán las usadas para regenerar.
————-

See on Scoop.itNovedades Cientificas y Médicas

El ADN y el ARNm importan

15 noviembre, 2014

Source: A stuck ribosome could be rescued by factors that released it from the mRNA and chewed up the damaged transcipt. But if the factors involved in this quality-control system were absent, damaged mRNA accumulated in the cell, just as it does in Alzheimer’s.

EL ADN Y EL ARNm IMPORTAN
————————-
El daño al ADN es un problema para todas las células, en particular en el cáncer, donde los mecanismos que reparan el daño normalmente fallan. Los mismos agentes que dañan el ADN también dañan su molécula hermana, el ARN mensajero (ARNm), que transporta las transcripciones de los genes a las decenas de miles de los ribosomas en cada célula. Pero poca atención se ha prestado a este daño. “Todo el mundo pensaba, ‘¿Para qué preocuparse por el ARN mensajero?. Estas moléculas tienen altas tasas de rotación y se degradan rápidamente, así que ¿qué importa si una está dañada?'”, Dijo Hani Zaher, PhD, profesor asistente de biología en Artes y Ciencias en Universidad de Washington en St. Louis.
————-
“En organismos como E. coli o la levadura, esto quizás sea probablemente cierto”, dijo Zaher. “Usted no tiene que preocuparse de ARNm, ya que da la vuelta muy rápido. Pero en las neuronas no se puede usar ese argumento porque un ARNm puede persistir, en algunos casos por días. Y si ese ARNm es realmente dañado, puede convertirse en un gran problema. Puede haber casos en los que el ARN mensajero es tan importante como el ADN. Es evidente que el daño oxidativo del ARN esta de alguna manera involucrado en las enfermedades neurodegenerativas, como el Alzheimer y ALS. No es necesariamente que causen la enfermedad, puede ser una especie de subproducto, pero está en la mezcla”.
————
En condiciones normales sólo el 1 % de los ARNm celulares se oxida, dijo Zaher, pero si usted estrés oxidativo, por cualquier razón, un porcentaje más alto se puede dañar. Una de las características de la enfermedad de Alzheimer es el estrés oxidativo, y los estudios han demostrado que en las personas con Alzheimer avanzado, la mitad de las moléculas de ARN en las neuronas puede estar oxidado. En la edición de noviembre 13 del Cell Reports, Zaher, Simms y sus colegas informan que cuando alimentan ARNm oxidados a los ribosomas, las nanomáquinas que convierten ARNm en proteína se atascan y se detuvieron. Un ribosoma atascado podría ser rescatado por factores que se publican desde el ARNm y procesan la Transcripción del daño. Pero si los factores del sistema de control de calidad estan ausentes, el ARNm dañado se acumula en la célula, tal como lo hace en la enfermedad de Alzheimer.
———–
Los 3 procesos celulares esenciales para la vida (que son realizar una copia del ADN, la copia de ADN en ARNm y la traducción del ARNm en proteína) han sido penalizados por miles de millones de años de evolución, si se produce algún descuido. Los errores en la copia de ADN se producen sólo una vez cada 1.000 millones de eventos. Cuando el ADN se transcribe a ARNm, hay un error aproximadamente una vez cada 10.000 eventos .y cuando el ARNm se traduce a la proteína, podría haber un error una vez cada 1.000 eventos. Para poner a prueba la solidez del proceso, el laboratorio Zaher se dispuso intervenir dando transcripciones de ARNm defectuosos a los ribosomas. Para ello dañaron una letra en una unidad de mRNA de tres letras de codificación, la oxidación de un G (guanina la base), para crear lo que se llama 8-oxo-G.
———–
“Elegimos esta base oxidada”, dijo, “porque sabíamos que cuando se copia el ADN, un G oxidado provoca un error. En lugar de apareamiento con una C, ya que normalmente, 8-oxo-G se asociará con una A”. Pensó que el ribosoma leería el codón de tres letras C [8-oxo-G] no como CGC sino más bien como CAC y por ello C pone el aminoácido equivocado en la cadena de proteína que estaba haciendo. Pero cuando se añadió 8-oxo-G a una sopa que contenía todos los factores necesarios para traducir el ARNm en proteína, sucedió algo sorprendente. “Esperábamos obtener proteínas aberrantes”, dijo Simms. “Pero el ribosoma no comete errores. Sólo se detuvo. No podía hacer frente a la ARNm en absoluto”. Podria decirse que estaba atascado porque los niveles de la proteína codificada, los ARNm defectuosos se desplomaron. Para asegurarse de que era la presencia en lugar de la posición de la 8-oxo-G que importaba, Simms hizo mRNAs con la 8-oxo-G en cada una de las tres posiciones de la unidad de codificación de tres letras. Y cada vez que el ribosoma se estancó.
———-
Sabiendo que habían encontrado algo interesante, los científicos aumentan su juego. Simms construyó un mRNA de 300 nucleótidos más largo para usar como una sonda. Y en lugar de añadir el ARNm dañado para un sistema bacteriano reconstituido, lo puso en extractos de células vegetales y animales. No podríamos mirar a los ribosomas en los extractos, dijo Simms, pero podía mirar las proteínas que han hecho. Ellos hicieron proteínas cortas, exactamente la longitud era de esperar si el ribosoma se detiene en la base dañada”. Un único ARNm normalmente tiene varios ribosomas que viajan a lo largo de ella, toda la traducción de esta transcripción simultánea en proteína. Cuando el primer ribosoma se detiene, los otros se amontonan detrás de él. Se obtiene este pequeño producto, que obtiene productos aún más pequeños está diciendo que hay múltiples ribosomas pegados detrás del primer ribosoma. Así que las copias de seguridad en los ribosomas hacen una escalera de péptidos”, dijo Zaher. “Este es un problema”, dijo. “Entre otras cosas, el ribosoma es una máquina costosa en el que la célula ha invertido una gran cantidad de energía en fabricar y ahora está atrapado en un ARNm. Usted necesita esos ribosomas de nuevo”.
———–
Afortunadamente los ribosomas tienen 3 sistemas de control de calidad que velan por los errores en el ARNm y los rescatan si detectar errores graves. Uno de estos sistemas es “no-go decadencia.” Cuando los ribosomas son atascados y no pueden seguir adelante, reclutan factores que agregan una etiqueta al péptido defectuoso que lo marca para su degradación”. “Cuatro mil millones de años de evolución ha hecho que su genoma no tiene secuencias que forman horquillas, por lo que estos no son claramente los objetivos previstos para la no-go decadencia”, dijo Zaher. Para averiguarlo, los científicos se centraron en las células de levadura. Si los ribosomas de la levadura atascado en el ARNm oxidado fueron rescatados por no-go decaimiento, muy poco dañado mRNA se acumularía en la célula. En esta levadura nocaut el nivel de ARNm oxidado subió. Luego se elimina el gen de un factor que es reclutado para degradar el ARNm después de soltar el ribosoma, y de nuevo el nivel de ARNm oxidado se levantó. Sin no-go decadencia, las células fueron claramente en problemas. El sistema que traduce el ARNm en una proteína está altamente conservada, por lo que, lo cierto para la levadura es probablemente cierto para la gente también”, dijo Zaher.
—————
Estan los ARNm oxidados implicados con las enfermedades?. Los trabajos recientemente publicados muestran que los ratones con un doble defecto en su sistema de traducción tienen enfermedad neurodegenerativas graves, dice Zaher. Uno de los defectos es un error en el ratón t-RNA (otro tipo de ARN implicados en la traducción) que atasca el ribosoma y el otro es un defecto en el sistema que rescata el ribosoma cuando se cala. Los ratones con ambos defectos comienzan a tener problemas para caminar y mueren en pocas semanas, dijo Zaher. La gente siempre ha dicho que el ARNm es sólo un intermediario, dijo Simms: “ADN y proteínas son los factores claves. El ARN, estamos viendo que es importante, mucho más de lo que creíamos. Es claro que el ARNm importa. “Es por eso que hemos desarrollado tres vías independientes para asegurarse de que los ARNm rotos no cuelguen alrededor por mucho tiempo”.
—————

See on Scoop.itNovedades Cientificas y Médicas

Aprender más sobre genes y enfermedad

14 abril, 2014

See on Scoop.itNovedades Cientificas y Médicas

Refernan Ref‘s insight:

REORDENANDO CONCEPTOS CON LA GENÉTICA Y EPIGENÉTICA

 

Identificar las causas genéticas de enfermedades comunes no es fácil, pues múltiples genes pueden estar involucrados en ellas y ademas las variantes que causan enfermedades en el ADN a menudo no actúan directamente, sino por activación de los genes vecinos. Este nuevo estudio da los primeros pasos para crear una hoja de ruta que ayude a ver las causa genética de numerosas enfermedades y también arrojará nueva luz sobre cómo la herencia y el medio ambiente pueden afectar la expresión génica.

 

Para añadirle complejidad, la activación genética no es tán simple como encender o apagar la luz, se comporta más como un “regulador de intensidad” – por el cual algunas personas pueden tener un gen particular girado totalmente hacia arriba, mientras que otros, lo tiene a mitad de camino o algo intermedio. Y factores como el ADN o el medio ambiente, juegan un papel en la configuración del regulador de intensidad.

 

Todo el mundo parece tener el mismo conjunto de genes. Y es difícil determinar qué genes son hereditarios o controlada por su ADN, y que genes pueden verse afectados por el medio ambiente (dieta y ejercicio). Conocer sobre la diferencia entre la herencia y el medio ambiente es clave para reducir el campo, cuando se está buscando la causa de una enfermedad en particular. Los gemelos idénticos tienen un ADN idéntico, explica Wright, por lo que si un gen es heredable, su expresión será más similar en los gemelos que en los mellizos.

 

Este proceso nos ha permitido crear una base de datos de genes hereditarios, que después se podría comparar con los genes implicados en el riesgo de enfermedad. Vimos que los genes hereditarios son más propensos a ser asociados con la enfermedad, algo que puede ayudar a otros investigadores a determinar qué genes son para centrarse en ellos en estudios futuros.

 

Este estudio, es por lejos, el mayor estudio doble de la expresión génica que se haya publicado en el mundo, lo que nos permite hacer una hoja de ruta de los genes frente al medio ambiente, dice Sullivan, quien agregó que el estudio, midió la relación con la enfermedad de forma más precisa que antes y descubrió importantes conexiones a la reciente evolución humana y la influencia genética en la enfermedades. El estudio aparece en línea el 13 de abril en la revista Nature Genetics.

 

Las 50 empresas más inteligentes de 2013

20 marzo, 2014

See on Scoop.itNovedades Cientificas y Médicas

TOP 50 COMPAÑIAS MAS INNOVADORAS EN EL MUNDO

 

Refernan Ref‘s insight:

Las 50 empresas están clasificadas más o menos arbitrariamente. Sin embargo, tres empresas, Illumina, Tesla, y Google, lideran la lista de forma justificada gracias al grado de disrupción de sus tecnologías y la inteligencia con la que han construído sus negocios.

Illumina, es una compañía que aprovecha el mecanismo de copia fundamental de ADN con el fin de leer la secuencia de un genoma humano. (El proceso se denomina secuenciación por síntesis: bases etiquetadas mediante fluorescencia que se añaden a hebras individuales de ADN de una muestra y después se leen de forma masiva y multiplexada). A partir de una tecnología que inventó Solexa, Illumina aumentó el ritmo de secuenciación y logró bajar su costo (5 veces más rápido que la Ley de Moore). Las máquinas de Illumina son lindas a la vista: elegantes, sin botones y tan potentes que pueden generar un genoma por 1.000 dólares(730 euros).

Cuando se hizo el Proyecto del Genoma Humano costó 3,000 millones de dólares y en 2006 secuenciar un genoma humano costaba 10 millones de dólares. El impacto producirá nuevas categorías de medicamentos, mejor adecuación de los procesos terapéuticos así como información sorprendente sobre lo que nos hace humanos.

Las tecnologías de Illumina, google Glass y Bitcoin son disruptivas (en el sentido de que nuevos mercados para productos nuevos desplacen a mercados y productos de más edad, así como a todos los hábitos humanos asociados a ellos). Habrá que esperar su maduración.

See on www.technologyreview.es

Estrategía SENS ¿Qué es?

26 febrero, 2014

See on Scoop.itNovedades Cientificas y Médicas

En el gráfico se muestra lo que esta linea de investigación, llamada SENS, considera las causas del envejecimiento humano y con que terapias puede combatirse cada uno de ellos. Mas abajo detallamos y hablamos un poco de cada una de ellas para tener mejor idea sobre lo que significa este tema.

Refernan Ref‘s insight:

Sigue un listado de estas 7 causas y su estado actual-

1) AmyloSENS: extracción de basura intercelular

La forma más conocida de basura extracelular es la beta-amiloide: que forma placas en los cerebros de los pacientes con la enfermedad de Alzheimer, y también (más lentamente) en todos los demás, y deteriora la función cognitiva. También hay una variedad de agregados similares que se forman en otros tejidos durante el envejecimiento y contribuiyen a enfermedades relacionadas con la edad, incluyendo amiloide de islotes en la diabetes II y la amiloidosis cardíaca senil, la cual es un importante contribuyente a la insuficiencia cardíaca. De hecho, hay cierta evidencia de que la amiloidosis cardíaca senil puede ser la principal causa de muerte en las personas que sobreviven más allá de 110 años de edad.

La solución

Los Agregados extracelulares pueden ser removidos desde el cerebro y otras áreas del cuerpo por anticuerpos especializados que apunten en concreto sobre ellos y los eliminen del tejido. Hay dos formas principales para introducir estos anticuerpos: vacunas “activas” y “pasivas”. Las vacunas activas introducen un pequeño fragmento del amiloide para estimular a las células del sistema inmune al ataque. Las vacunas pasivas implican realizar los anticuerpos fuera del cuerpo e introducirlos a través de la inyección.

Más recientemente, una prometedora variación de este enfoque ha sido desarrollado. Dr. Sudhir Paul de la Universidad de Texas Medical School en Houston, que descubrio que un subconjunto de anticuerpos humanos tienen actividad catalítica frente a un antígeno en particular, lo descompone en fragmentos pequeños y menos dañinos en lugar de atraparlo para la eliminación o destrucción por otras células inmunes.  Vacunas contra los amiloides son actualmente investigadas. De hecho, varias vacunas dirigidas a la beta-amiloide se encuentran actualmente en ensayos clínicos avanzados, y otros se encuentran en distintas etapas de la investigación con animales. El más ambicioso de estos ensayos es la Iniciativa de Prevención del Alzheimer : un niño de cinco años y $ 100 millones de pruebas de estudio para ver si la vacuna del beta-amiloide puede prevenir la enfermedad en las personas cuyos genes hacen que se producen más beta-amiloide que la mayoría de la gente, y que, por tanto, desarrollar la enfermedad de Alzheimer a una edad mucho más joven que el resto de nosotros.

2) ApoptoSENS: Eliminación de las células disfuncionales

Nuestras células a veces ellos se desvían lejos de su normal destino. El número de estas células en los tejidos aumenta gradualmente con el tiempo, hasta que por nuestra quinta década empiezan a alcanzar niveles que son perjudiciales para la función del tejido normal (tenemos células senescentes clasicas, células del tejido graso, células inmunes).  .

La Solución

Cada uno de estos diversos tipos de células anormales se producen en diferentes tejidos, y los problemas que causan son distintos el uno del otro. Sin embargo, hay 2 estrategias básicas que puede ser usada para eliminarlas: Desarrollar un medicamento que es tóxico para las células no deseadas, o que les hace cometer suicidio, pero que no hace daño a las células sanas, normales, oEstimular el sistema inmunológico para buscar y matar selectivamente las células diana.

En la Universidad de Arizona, la Fundación de Investigación SENS está financiando la investigación para restaurar la salud del sistema inmune en los ratones que envejecen, aumentando al mismo tiempo la capacidad de producir nuevas asesinas células T, dejando margen para ellos purgando células defectuosas desde el sistema.

3) GlycoSENS: entrecruzamientos extracelulares 

El buen funcionamiento de tejidos se basa en proteínas constituyentes que mantienen su estructura adecuada. Tales proteínas son responsables de la elasticidad de la pared de la arteria, la transparencia de la lente del ojo, y la alta resistencia a la tracción de los ligamentos, por ejemplo. Pero ocasionalmente, el azúcar en la sangre (y otras moléculas en los fluidos en el que se bañan estos tejidos) reaccionarán con estas proteínas, creando enlaces químicos denominados enlaces cruzados (Crosslinks) que actúan como moleculas “esposas”, tomando dos proteínas vecinos que antes eran capaces de moverse independientemente uno del otro y unirlos, deteriorando su función en la misma forma que ocurre con los participantes en una carrera de tres piernas.

En el caso de la pared de la arteria, por ejemplo, la reticulación de las cadenas de la proteína colágeno impide separar una de la otra para acomodar el aumento del pulso por la acción de bombeo del corazón. A medida que más y más cadenas de colágeno se vuelven reticuladas con el tiempo, los vasos sanguíneos se vuelven cada vez más rígido, lo que lleva a un aumento gradual de la presión arterial sistólica con la edad. Con la pérdida del efecto amortiguación proporcionado por el colágeno, el movimiento libre en los vasos sanguíneos, la fuerza de la oleada de sangre que es impulsada dentro de las arterias por la acción de bombeo del corazón, llega directamente a órganos como los riñones y el cerebro, provoca daños a las estructuras que filtran la sangre y que conecte las regiones funcionales de nuestro cerebro, y nos pone en riesgo de un accidente cerebrovascular. Además del daño químico también hay daños mecánicos. Una forma sutil de los daños mecánicos que probablemente contribuye a la rigidez de las grandes arterias y de otros órganos como el pulmón a través del tiempo es el desgaste y rotura de estructuras hechas de la proteína elastina elástica.

La Solución

Afortunadamente, los entrecruzamientos que se producen como accidentes químicos en nuestros tejidos estructurales tienen estructuras químicas muy inusuales, que no se encuentran en las proteínas u otras moléculas que el cuerpo produce a propósito.  Esto debería hacer posible la identificación o drogas de diseño que pueden reaccionar con los enlaces cruzados, sin romperse ningún transeúntes estructurales esenciales.

De hecho, hace varios años un grupo de químicos parecía haber encontrado una molécula de este tipo: una droga llamada alagebrium (o ALT-711 ), lo que reduce sustancialmente la presión arterial en el envejecimiento o diabéticos, además de varios otros efectos beneficiosos en animales, pero en humanos, los efectos eran leves y limitados. Esto puede ser debido a que el tipo de reticulación que alagebrium Severs es mucho más raro en los seres humanos de lo que es en roedores y otros animales de experimentación, o tal vez porque el fármaco tiene propiedades beneficiosas adicionales en animales que se extienden más allá de las reticulaciones se rompen que son menos importantes en los seres humanos.
Ahora se sabe que el que más contribuye a la reticulación de colágeno en seres humanos es una molécula llamada glucosepane, y los fármacos que escinden esta molécula es probable que tengan el efecto rejuvenecedor más fuerte en la elasticidad de los tejidos. Pero glucosepane puede ser una molecula demasiada compleja para ser rota por medicamentos. Por lo que algunos nuevos enfoques merecen explorarse, como por ejemplo, la ingeniería de enzimas, en lugar de las drogas, para romper los enlaces cruzados.

4) LysoSENS: Eliminar residuos fuera de las células

Las células tienen una variedad de sistemas para la descomposición y el reciclaje de estos materiales no deseados. Uno de estos sistemas es el lisosoma, una especie de “incinerador” celular que contiene las enzimas más poderosas de la célula para romper las moléculas destrozados en pedazos manejables. Sin embargo, a veces estos componentes están tan fusionados que ni siquiera el lisosoma es capaz de separarlos. Y si hay algo que no se puede descomponer en el lisosoma, no hay otro lugar para que vaya: sólo se queda allí hasta que el lisosoma rompe desastrosamente, o la propia célula es destruida.

Pero a medida que los macrófagos consumen más y más de estos materiales tóxicos, los lisosomas se congestionan con subproductos que no pueden romper. Con el tiempo, dejan de funcionar, y, o bien se convierten en disfuncionales en la pared de la arteria, o mueren de plano.
Esta acumulación de macrófagos enfermos y muertos en la pared de la arteria es la base de la aterosclerosis, las placas en las arterias que son responsables de la enfermedad cardíaca. A medida que sus números aumentan gradualmente con el tiempo, las olas de lesiones y se encona hasta que finalmente estalla, arrojando coágulos y otros materiales que provocan los ataques cardíacos y accidentes cerebrovasculares.

La Solución

Puesto que la raíz del problema es que el lisosoma es incapaz de descomponer todos estos productos de desecho difíciles, la solución más directa es para que les suministren nuevas enzimas que pueden degradar los desechos. Y, afortunadamente, sabemos que existen enzimas capaces de descomponer estos materiales – en concreto, en las bacterias y hongos del suelo que ayudan a descomponer los cadáveres.  Si no existieran tales enzimas, entonces el planeta estaría hasta los tobillos en desechos lisosomales no degradados sobrantes de las células de los 600 millones de años de la vida animal en el planeta.  Así que identificar las enzimas que estos organismos usan para digerir los desechos lisosomales, modificarlos para trabajar en el entorno del lisosoma humana, y luego entregarlos a donde tienen que ir en nuestras células.

5) MitoSENS: Prevenir daños por mutaciones mitocondriales

Las mitocondrias son las máquinas que viven dentro de las células y actúan como sus “plantas de poder”, convierten los nutrientes ricos en energía, los alimentos en ATP, la forma de energía que directamente alimenta las reacciones bioquímicas en la célula. A diferencia de cualquier otra parte de la célula, las mitocondrias tienen su propio ADN (mtADN), separado del ADN en el núcleo de la célula, donde se mantienen todo el resto de nuestros genes.

Las mitocondrias generan residuos tóxicos al generar energía de los alimentos que quema como combustible, escupiendo moléculas reactivas llamadas radicales libres, que pueden dañar las estructuras celulares. Y el ADNmt es especialmente vulnerable a estos radicales libres, ya que se encuentra tan cerca del centro de su producción.

La Solución

la estrategia MitoSENS es aceptar que las mutaciones mitocondriales pasen, pero diseñar un sistema que evite el daño que causan a la célula. Podemos hacerlo poniendo “copias de seguridad” de los genes mitocondriales en el núcleo, donde no puedan ser dañados por los radicales libres generados en la mitocondria. De esta manera, incluso si se eliminan los genes originales de la mitocondria, las copias de seguridad será capaz de proporcionar las proteínas necesarias para mantener la producción normal de energía en marcha, permitiendo que las plantas de energía celular siga con normalidad. Este enfoque se denomina expresión allotopic de las proteínas. Hoy en día, el ADN mitocondrial contiene instrucciones para la construcción de tan sólo 13 proteínas que necesitan las mitocondrias.

6) OncoSENS: Hacer mutaciones cancerosas inofensivas

Hay dos tipos de daños que se acumulan en nuestros genes a medida que envejecemos: mutaciones y epimutaciones.Las mutaciones son daños a la secuencia de ADN en sí, mientras que epimutaciones son daños en el “andamiaje” que el ADN, el cómo y cuando los genes se excitan en la célula.

A efectos prácticos, ambas mutaciones y epimutaciones finalmente nos hacen daño de la misma forma: hacen que la expresión del gen anormal, ya sea aumentando o disminuyendo la cantidad de una proteína codificada por el gen que produce, mediante la alteración en las condiciones en que esa producción es activada, o mediante la alteración de la estructura y función de la proteína resultante en sí. Debido a sus efectos similares, un enfoque que evita las consecuencias negativas de estos cambios en la expresión génica se puede usar para hacer que los dos tipos de daños sea inofensivo, a pesar del hecho de que la base molecular de las mutaciones y epimutaciones son bastante diferentes.

Lo que la mayoría de la gente sabe acerca del cáncer, es que resulta de una serie de (epi) mutaciones que ocurren en secuencia en la célula, lo que conduce a su crecimiento descontrolado. Otros tipos de mutaciones (epi) también se producen en nuestras células con el tiempo, y algunos científicos se han preocupado de que estas mutaciones no causan cáncer (epi) también podrían contribuir de distintas maneras a la enfermedad relacionada con la edad y la discapacidad.

Pero hay buenas razones para creer que no hay suficientes de estas mutaciones que en realidad tienen un impacto significativo en nuestra salud. Esto se debe a la amenaza del cáncer de incluso, una sola (epi) mutación es tan grande que obliga al cuerpo a desarrollar defensas contra (epi) mutaciones que superan con creces lo que sería necesario para evitar una carga significativa de la no-cáncer (epi) mutaciones que se produzcan.

Una solución intermedia: Los fármacos que inhiben la telomerasa

El hecho de que el cáncer parece ser la única (epi) mutaciones relacionadas con la edad que perjudican nuestra salud, simplifica las cosas mucho. Así que a pesar de su diversidad, todas las células de cáncer comparten algo fundamental en común: son dependientes para su supervivencia de su capacidad para secuestrar la telomerasa (o, con menor frecuencia, ALT). Este hecho ha llevado a buscar drogas que inhiban la actividad de la telomerasa en las células cancerosas.

La terapia de fármacos inhibidores de telomerasa estaría limitada por dos factores: El primero es que algunos tipos de cáncer usan el mecanismo de ALT en lugar de la telomerasa para mantener sus telómeros largo y aqui inhibir la telomerasa no hará nada. El segundo es el hecho de que el cáncer se reproduce a una velocidad de vértigo, pero su código genético es tremendamente inestable, por lo que nuevas mutaciones aparecen constantemente en las células dentro del tumor. Como resultado, están tirando continuamente nuevas líneas de células cancerosas, cada uno de los cuales tiene un código genético ligeramente diferente y propiedades distintas.
Esto permite al tumor el poder de la evolución de superar las drogas. También explica por qué inicialmente se responde bien a la quimioterapia y muchos meses más tarde, una nueva forma desarrolla resistencia al medicamento. Esto haría que un fármaco que inhibe la actividad de la telomerasa, simplemente es probable que deje de funcionar.

hay una estrategía OncoSENS de último recurso que derrotaría todo el cáncer – totalmente y de forma permanente. Se inicia a partir de los mismos hechos claves de necesitar alargar sus telómeros y su adaptación al medicamento. Esta estrategia (que era el tema de la tercera mesa redonda SENS) se llama “Wilt“, y es parar el alargamiento de telomeros en todo el cuerpo, no solo en las células cancerosas.  En pocas palabras, el cáncer no puede explotar la telomerasa y ALT para mantenerse con vida, si no existen los genes que codifican la maquinaria!, y esto haría imposible crecer para los cánceres, a menos que se las arreglan para crear una telomerasa completamente nueva o un gen ALT de la nada – una posibilidad infinitamente improbable.

Hay dos problemas posibles aqui con esta solución: La primera es que aunque la mayoría de nuestras células no usan la telomerasa, algunas, especialmente las células madre, lo hacen y eliminar el gen significaría que estas células sanas se quedaría sin respaldo telomérica. Eso significaría que nuestras células madre ya no serían capaces de producir nuevas células para reponer los tejidos y los tejidos comenzarían a atrofiarse prematuramente.

De hecho, esto es exactamente lo que ocurre en la disqueratosis congénita, una enfermedad asociada con el mantenimiento de los telómeros inadecuados. Pero hay una manera de evitar este problema. La reserva de los telómeros de las células madre parece ser suficiente para mantener a las células normales por alrededor de una década. Así que para apoyar la capacidad de nuestros tejidos de renovarse indefinidamente, sería suficiente para reemplazar aquellos que fallan las reservas de células madre con células nuevas una vez por década. Y mediante el diseño de estas células madre frescas que no tienen telomerasa o genes de ALT de los suyos, pero para tener telómeros que son lo suficientemente largo cuando primero se trasplantaron a una persona para durar una década en la fuerza de los telómeros originales, nuestros tejidos haría siempre tienen las células madre funcionales que necesitan para el mantenimiento, pero las células madre presentes en el tejido en un momento dado serían simplemente incapaces de desarrollarse en cánceres potencialmente mortales.

El otro problema potencial a la estrategia WILT sería si la telomerasa o ALT tenían alguna función esencial que no sea el alargamiento de los telómeros, por lo que la eliminación de los genes para su maquinaria podría también comprometer alguna otra función, esencial. Se han realizado algunos estudios, el más riguroso hasta hoy, sugiere fuertemente que no hay otras funciones al alargamiento de telómeros de la telomerasa.

7) RepleniSENS: Sustitución de las células perdidas

Cada día nuestras células son dañadas. Algunas son reparadas, pero otras son destruidas o forzadas a cometer suicidio (apoptosis) por el bien del cuerpo. El resultado neto es que en el transcurso de décadas, los tejidos de larga duración como el cerebro, el corazón y los músculos esqueléticos comienzan a perder progresivamente células, y su función se ve cada vez más comprometida. Los músculos se debilitan, el cerebro pierde neuronas, y eso contribuye al deterioro cognitivo y la demencia, así como a la pérdida de control sobre los movimientos de los músculos finos (un proceso que termina en la enfermedad de Parkinson).

El timo – que es una glándula en el esternón, donde una clase importante de las células inmunes maduras – se contrae, haciendo que seamos más vulnerables a las enfermedades infecciosas pues se producen menos células inmunes frescas. El deterioro del timo con la edad es una de las dos razones principales (junto con la acumulación de células defectuosas) por qué llegamos a ser cada vez más vulnerables a la gripe, la neumonía y otras enfermedades infecciosas a medida que envejecemos.
La ingeniería de tejidos del timo sana y joven ayudaría a restablecer la respuesta inmune vigorosa de la juventud. En la Wake Forest University Institute de Medicina Regenerativa, la financiación de la Fundación de Investigación SENS está ayudando el laboratorio del Dr. John Jackson intensificar la investigación sobre la ingeniería de un nuevo timo, con el fin de restaurar la función inmune juvenil.
La división celular es estimulada naturalmente en algunos músculos por el ejercicio, pero el mayor volumen de tejido muscular y la fuerza es el resultado de aumentar el tamaño de las células, en vez de agregar nuevas células al tejido. Estos procesos también pueden ser estimulados artificialmente via inyección de esteroides anabólicos y otros factores de crecimiento, pero con efectos secundarios, como el cáncer.

La Solución

La terapia celular y la ingeniería tisular, la ciencia de cultivar órganos para trasplante en un andamio biodegradable artificial fuera del cuerpo. Los fundamentos de esta forma de medicina se encuentran en el trasplante de órganos y tejidos que ya utilizamos para reemplazar la sangre de los pacientes de quimioterapia o de los riñones de los pacientes en diálisis.  Pero aún el potencial terapéutico se ve limitada por el número limitado de órganos y células para trasplante y además, el trasplante produce un rechazo y ataca el tejido donado. Esta reacción inmune tiene que ser suprimida con fármacos de por vida.

Dos nuevas tecnologías repleniSENS harán de estos problemas una cosa del pasado. Estas tecnologías permiten que nuevas células y órganos se hagan a la medida para el destinatario, a partir de sus propias células. Esto elimina la necesidad de donación y el rechazo.
Los científicos comienzan con células maduras (como la piel o las células sanguíneas) extraídas de la persona y restauran en ellas los poderes perdidos de las células madre embrionarias: al transformar el tipo de célula y para mantener la reproducción inevitablemente.

El primer método implica: reprograma las células del estado de madurez en el estado embrionario generando “células madre pluripotentes inducidas”, una variante de este método permite tomar células que son de un tipo diferente de las células que se necesitan, pero presentes en el mismo tejido y reprogramarlas a las células necesarias sin pasar por el estado embrionario. Se usaron asi células de la piel para transformarlas en células musculares del corazón.  El segundo método crea nuevas células similares a las embrionarias a partir de células adultas, fusionando un óvulo de una donante con células de la persona que necesita células, usando la técnica experimental de transferencia nuclear de células somáticas (o “clonación terapéutica”).

Cómo aplicar estas terapías de Rejuvenecimiento Biotecnologico

Las proteínas por lo general no se puede dar en forma de píldora, tienen que ser inyectadas, lo que puede ser un inconveniente y causar malestar. También, la mayoría de las proteínas son degradadas rápidamente, por la maquinaria de reciclaje de la célula y otros procesos metabólicos, eso hace muy difícil entregar la cantidad requerida para tener efecto terapéutico. Hay problemas similares con la entrega de ARN , las “copias de trabajo” de las instrucciones genéticas que indican a las células cómo construir proteínas por sí mismos.

Un reto adicional viene por la gran cantidad de diferentes terapias de proteínas (o ARN), basados en cada uno de los daños, su eliminación o la reparación, que son requeridos para mantener el vigor juvenil sano. Si cada una de estas muchas terapias basadas en proteínas tuvieran que ser entregado via inyección periódica, esto podría implicar una ida frecuente a la clínica de rejuvenecimiento para el programa completo de las sesiones de regeneración de una persona.

Aún más desafiante, es el gran tamaño de las proteínas hace difícil conseguir terapias basadas en proteínas y llevarlas a los tejidos donde se necesitan para reparar y rejuvenecer las estructuras celulares y moleculares locales. El más importante de estos casos es el cerebro.

Como alternativa a la entrega de proteínas terapéuticas (o ARN) a través de pastillas o inyecciones, muchas biotecnologías de rejuvenecimiento pueden producirse directamente en los propios tejidos donde son necesitadas. Hay dos formas principales de hacerlo: el transplante de células y tejidos diseñados con la capacidad de producir las proteínas necesarias en ellos y la terapía génica sómatica, para diseñar la capacidad en nuestros tejidos existentes.

Terapia génica de la línea germinal – algunas consideraciones

Por último, unas palabras sobre la llamada terapia génica de “línea germinal” – es decir, cambiar el genoma en el espermatozoide u óvulo, o de un óvulo fecundado, por lo que la gente ya nace con un gen terapéutico en sus células. 

Algunas personas piensan que esto siempre sería demasiado peligroso para ser útil, mientras que otros han argumentado persuasivamente que estos peligros se pueden superar. Fundación SENS no se pronuncia sobre este tema, debido a que la respuesta no es realmente importante para nuestra misión.

Cualquier terapias para prevenir o revertir la enfermedad relacionada con la edad y la discapacidad que necesite ser diseñada antes de nacer,  no sería de ninguna utilidad para aquellos de nosotros que hoy vivimos, debido al tiempo que es necesario transcurra.

Para las generaciones venideras, las terapias de la línea germinal ofrecen menos beneficios de lo que cabría pensar al principio. Esto se debe a que, mientras que el daño celular y molecular que eventualmente conduce envejecimiento degenerativo comienza a ocurrir mientras estamos todavía en el útero, y se necesitan muchas décadas para que el monto de dichos daños sea tan extenso como para perjudicar nuestra salud.

Parece que no habría ventajas de tener las biotecnologías rejuvenecimiento  presentes y activos en nuestros tejidos en el nacimiento, o incluso hasta nuestros veinte o treinta años: la cantidad de daño en los tejidos aún es inofensivo, como se desprende de la salud y el vigor de personas en estos grupos de edad.

El objetivo nuestro no es prevenir todo el daño del envejecimiento que se produzca, sino evitar que este daño alcance el umbral en el que comienza a hacernos daño, algo que comienza a los cuarenta o más años.

A %d blogueros les gusta esto: